Previous Contig 011982:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF035P06Sequence677011982 (2)gb:AY075621_15677657e-78Arabidopsis thaliana AT4g37080/C7A10_280 mRNA, complete cds.>gb:BT000819_1635074
JMSF017N15Sequence311019049748011982 (2)gb:AY075621_15677657e-86Arabidopsis thaliana AT4g37080/C7A10_280 mRNA, complete cds.>gb:BT000819_1635074

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF017N15+ GATCTGAAAGGCCTCTCTCACCAGGAGA
                      ____________________________________________________________
consensus GATCTGAAAGGCCTCTCTCACCAGGAGA
 
. : . : . : . : . : . :
rJMFF035P06+ TCTATAATTCATGCATGATGAATGCATATCTAGAGAACG
rJMSF017N15+ AGCTTGCATTCTGGTTAAACATCTATAATTCATGCATGATGAATGCATATCTAGAGAACG
                      ____________________________________________________________
consensus AGCTTGCATTCTGGTTAAACATCTATAATTCATGCATGATGAATGCATATCTAGAGAACG
 
. : . : . : . : . : . :
rJMFF035P06+ GAATTCCTGAGAATCCCGAAATGGTGGTGGCGTTGATGCAAAAGGCAACCATAAACGTTG
rJMSF017N15+ GAATTCCTGAGAATCCCGAAATGGTGGTGGCGTTGATGCAAAAGGCAACCATAAACGTTG
                      ____________________________________________________________
consensus GAATTCCTGAGAATCCCGAAATGGTGGTGGCGTTGATGCAAAAGGCAACCATAAACGTTG
 
. : . : . : . : . : . :
rJMFF035P06+ GAGGGCACTTGCTCAACGCGATTACCATTGAGCACTTCATTCTAAGGCTGCCTTACCACT
rJMSF017N15+ GAGGGCACTTGCTCAACGCGATTACCATTGAGCACTTCATTCTAAGGCTGCCTTACCACT
                      ____________________________________________________________
consensus GAGGGCACTTGCTCAACGCGATTACCATTGAGCACTTCATTCTAAGGCTGCCTTACCACT
 
. : . : . : . : . : . :
rJMFF035P06+ CGAAATATGTTTTTTCAAAGGCTGCAAAGAACGATGAGATGACAGCACGTAGCCTCTTCG
rJMSF017N15+ CGAAATATGTTTTTTCAAAGGCTGCAAAGAACGATGAGATGACAGCACGTAGCCTCTTCG
                      ____________________________________________________________
consensus CGAAATATGTTTTTTCAAAGGCTGCAAAGAACGATGAGATGACAGCACGTAGCCTCTTCG
 
. : . : . : . : . : . :
rJMFF035P06+ GTTTGGAGTTCTCCGAGCCATTGGTGACCTTTGCCCTCTCTTGTGGAAGTTGGTCATCCC
rJMSF017N15+ GTTTGGAGTTCTCCGAGCCATTGGTGACCTTTGCCCTCTCTTGTGGAAGTTGGTCATCCC
                      ____________________________________________________________
consensus GTTTGGAGTTCTCCGAGCCATTGGTGACCTTTGCCCTCTCTTGTGGAAGTTGGTCATCCC
 
. : . : . : . : . : . :
rJMFF035P06+ CTGCAGTGAGAGTCTATACTGCATCCAAGGTCGAAAGCGAGCTAGAAGTGGCGAAAAGAG
rJMSF017N15+ CTGCAGTGAGAGTCTATACTGCATCCAAGGTCGAAAGCGAGCTAGAAGTGGCGAAAAGAG
                      ____________________________________________________________
consensus CTGCAGTGAGAGTCTATACTGCATCCAAGGTCGAAAGCGAGCTAGAAGTGGCGAAAAGAG
 
. : . : . : . : . : . :
rJMFF035P06+ AGTACCTGCAGGCGACGATTGGGATATCGAGAAATGAGAAACTGGTGGCAATACCGAAGC
rJMSF017N15+ AGTACCTGCAGGCGACGATTGGGATATCGAGAAATGAGAAACTGGTGGCAATACCGAAGC
                      ____________________________________________________________
consensus AGTACCTGCAGGCGACGATTGGGATATCGAGAAATGAGAAACTGGTGGCAATACCGAAGC
 
. : . : . : . : . : . :
rJMFF035P06+ TGTTGGACTGGTACTTGCTCGATTTCGCCAAGGATATGGAGTCACTGCTGGATTGGGTGT
rJMSF017N15+ TGTTGGACTGGTACTTGCTCGATTTCGCCAAGGATATGGAGTCACTGCTGGATTGGGTGT
                      ____________________________________________________________
consensus TGTTGGACTGGTACTTGCTCGATTTCGCCAAGGATATGGAGTCACTGCTGGATTGGGTGT
 
. : . : . : . : . : . :
rJMFF035P06+ GCCTTCAGCTGCCAACTCACCTGGGAAAAGAAGCAATTACCTGTCTTGAGAGAAAGAATG
rJMSF017N15+ GCCTTCAGCTGCCAACTCACCTGGGAAAAGAAGCAATTACCTGTCTTGAGAGAAAGAATG
                      ____________________________________________________________
consensus GCCTTCAGCTGCCAACTCACCTGGGAAAAGAAGCAATTACCTGTCTTGAGAGAAAGAATG
 
. : . : . : . : . : . :
rJMFF035P06+ ATGAACATCTTTTGCAGGTTCTCCAGATCATGCCATATGAGTTTAGTTTCAGATACCTCA
rJMSF017N15+ ATGAACATCTTTTGCAGGTTCTCCAGATCATGCCATATGAGTTTAGTTTCAGATACCTCA
                      ____________________________________________________________
consensus ATGAACATCTTTTGCAGGTTCTCCAGATCATGCCATATGAGTTTAGTTTCAGATACCTCA
 
. : . : . : . : . : . :
rJMFF035P06+ TAAGCATATGAATCTTGTTTTGCTTTGGTTTTCTTCATTTACACTGATTCAAAAGCTTTC
rJMSF017N15+ TAAGCATATGAATCTTGTTTTGCTTTGGTTTTCTTCATTTACACTGATTCAAAAGCTTTC
                      ____________________________________________________________
consensus TAAGCATATGAATCTTGTTTTGCTTTGGTTTTCTTCATTTACACTGATTCAAAAGCTTTC
 
. : . : . : . : . : . :
rJMFF035P06+ AAGTTAGACTGTCAATATATATAGAAATAGTAGAGGTG
rJMSF017N15+ AAGTTAGACTGTCAATATATATAGAAATAGTAGAGGTGCATAAAGTGATTGAAGTATATG
                      ____________________________________________________________
consensus AAGTTAGACTGTCAATATATATAGAAATAGTAGAGGTGCATAAAGTGATTGAAGTATATG