Previous Contig 011977:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF015D23Sequence243011977 (2)gb:AP005966_18603644e-14Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, BAC clone:B104821022643gb:U42445_17263352e-18Lycopersicon pimpinellifolium leucine rich repeat protein Cf-2.2 gene, complete
JMSF017L24Sequence326005708 (6)pir|S61925|S619251e-05cyst wall protein 1 precursor - Giardia lamblia>gb:GLU09330_1385379 Giardia inte750011977 (2)gb:OSJN00162_16959502e-37Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0021F22, complete seque

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF017L24+ TCACAGTTATTTCTTGGACATGATACAAAG
                      ____________________________________________________________
consensus TCACAGTTATTTCTTGGACATGATACAAAG
 
. : . : . : . : . : . :
rJMSF017L24+ AGTGAGTATAATGATAGATGTGGCATCTGCTTTAGAATATCTCCACTATGGTTACTCCAA
                      ____________________________________________________________
consensus AGTGAGTATAATGATAGATGTGGCATCTGCTTTAGAATATCTCCACTATGGTTACTCCAA
 
. : . : . : . : . : . :
rJMSF017L24+ TCCTATTATCCATTGCGACTTGAAACCCAGTAATGTGTTAATAGATGCTGATATGGTGGG
                      ____________________________________________________________
consensus TCCTATTATCCATTGCGACTTGAAACCCAGTAATGTGTTAATAGATGCTGATATGGTGGG
 
. : . : . : . : . : . :
rJMSF017L24+ ATATTTGAGTGACTTTGGTGTTGCAAAGCTCTTAGGAGATGGGAATTCCATTGCCATTAC
                      ____________________________________________________________
consensus ATATTTGAGTGACTTTGGTGTTGCAAAGCTCTTAGGAGATGGGAATTCCATTGCCATTAC
 
. : . : . : . : . : . :
rJMSF017L24+ AAACACCTTAGCAACAATTGGTTACATTGCTCCAGGTAAATGTTTCAGTTTTTTTTTAAC
                      ____________________________________________________________
consensus AAACACCTTAGCAACAATTGGTTACATTGCTCCAGGTAAATGTTTCAGTTTTTTTTTAAC
 
. : . : . : . : . : . :
rJMSF017L24+ TTTCTCGATTTGATTTTAACATTCATCACATAACATTATGCATTTCTAATGGTTTCCTAT
                      ____________________________________________________________
consensus TTTCTCGATTTGATTTTAACATTCATCACATAACATTATGCATTTCTAATGGTTTCCTAT
 
. : . : . : . : . : . :
JMSF015D23+ CGTAGTGATATGT
rJMSF017L24+ CAAAATTTGCACTCCTAGAATATGGACAAGAAGGGCTTGTGTCCACACGTAGCGATATGT
                      ____________________________________________________________
consensus CAAAATTTGCACTCCTAGAATATGGACAAGAAGGGCTTGTGTCCACACGTAGTGATATGT
 
. : . : . : . : . : . :
JMSF015D23+ ACAGTTATGGTATCATGATGCTTGAAGTTTTCACAAGGATTCAACCTGCAGATGAAATGT
rJMSF017L24+ ACAGTTATGGCATTATGTTGCTTGAAGTTTTCACGAAGACTCAGCCTGGAGATGAAATGT
                      ____________________________________________________________
consensus ACAGTTATGGTATTATGTTGCTTGAAGTTTTCACGAGGATTCAGCCTGGAGATGAAATGT
 
. : . : . : . : . : . :
JMSF015D23+ TCAACGAAGATTTAAGTCTAAGAAGTTGGGTGCACAATGCATTTCCTACAAATATAAGTC
rJMSF017L24+ TCAGCGAAGATTTATGTCTGAGAAGTTGGGTGCACAATGCACTTCCTACAAATACAAATC
                      ____________________________________________________________
consensus TCAGCGAAGATTTATGTCTGAGAAGTTGGGTGCACAATGCATTTCCTACAAATATAAGTC
 
. : . : . : . : . : . :
JMSF015D23+ AGATTATAGACCCAAACTTACTTAAACCGGATGAAGAAAGGTACGATGAAAAATTGCAAT
rJMSF017L24+ AGATTATAGATCCAAATTTACTTAAACCAGGTGAAGAAAAGTACGATGAAAAGTTGCAGT
                      ____________________________________________________________
consensus AGATTATAGATCCAAATTTACTTAAACCGGGTGAAGAAAGGTACGATGAAAAGTTGCAGT
 
. : . : . : . : . : . :
JMSF015D23+ GTGCATTGGCTATCTTTGAGGTAGGCTTGAAATGCTCA
rJMSF017L24+ GTGTGTCGGCTATCTTTGAGATAGGCATGAAATGCTCAACAAAGTCGCCTCGAGAGAGGA
                      ____________________________________________________________
consensus GTGTGTTGGCTATCTTTGAGGTAGGCTTGAAATGCTCAACAAAGTCGCCTCGAGAGAGGA
 
. : . : . : . : . : . :
rJMSF017L24+ TGAATGTGAAAGATGCCTTATCAGCATTGATAAAGATCAAAGCCCAACTTCTTTCCCTGT
                      ____________________________________________________________
consensus TGAATGTGAAAGATGCCTTATCAGCATTGATAAAGATCAAAGCCCAACTTCTTTCCCTGT
 
. : . : . : . : . : . :
rJMSF017L24+ ATGCAAGTATTTAGAGTAGTATGTATTATTAGCATCTCCTATTGTATCTTTCTTAAAATG
                      ____________________________________________________________
consensus ATGCAAGTATTTAGAGTAGTATGTATTATTAGCATCTCCTATTGTATCTTTCTTAAAATG