Previous Contig 011973:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF017K15Sequence487008157 (3)pir|D96577|D965771e-42hypothetical protein F22G10.25 [imported] - Arabidopsis thaliana>gb:AE005173_893789011973 (2)gb:AC091787_17351071e-43Oryza sativa (japonica cultivar-group) chromosome 3 clone OSJNBa0087G11 map MAP_
JMSF053K01Sequence624008157 (3)pir|D96577|D965774e-56hypothetical protein F22G10.25 [imported] - Arabidopsis thaliana>gb:AE005173_893950011973 (2)gb:AC091787_17351074e-51Oryza sativa (japonica cultivar-group) chromosome 3 clone OSJNBa0087G11 map MAP_

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF053K01+ AACNGA
                      ____________________________________________________________
consensus AACNGA
 
. : . : . : . : . : . :
rJMSF053K01+ CAAATTACTTACTGGAGTTGATCAAACCTGCATTGATCCTTTTCTGGGCATGATCATGAT
                      ____________________________________________________________
consensus CAAATTACTTACTGGAGTTGATCAAACCTGCATTGATCCTTTTCTGGGCATGATCATGAT
 
. : . : . : . : . : . :
rJMSF053K01+ CAATGTACAGTGGTTCACACAACGAAGTATGGTGCTGTAAAAGAGGTAGTACTTCTTACT
                      ____________________________________________________________
consensus CAATGTACAGTGGTTCACACAACGAAGTATGGTGCTGTAAAAGAGGTAGTACTTCTTACT
 
. : . : . : . : . : . :
rJMSF053K01+ GATTTGTGTCATTGAAATTTTTTATCAACATGATGATGTTTGATAAATAACTTTCTGCAG
rJMSF017K15+ AG
                      ____________________________________________________________
consensus GATTTGTGTCATTGAAATTTTTTATCAACATGATGATGTTTGATAAATAACTTTCTGCAG
 
. : . : . : . : . : . :
rJMSF053K01+ CATACTCTAGGGACCATAAGCTGGCAGCAGGGAAATTTGTTTCCCTCTTTTATGTTGTTA
rJMSF017K15+ CATACTCTAGGGACCATAAGCTNGCAGCAGGGAAATTTGTTTCCCTCTTTTATGNTGTTA
                      ____________________________________________________________
consensus CATACTCTAGGGACCATAAGCTGGCAGCAGGGAAATTTGTTTCCCTCTTTTATGTTGTTA
 
. : . : . : . : . : . :
rJMSF053K01+ TCTGTTAGTAACCTTACCTCGTCAGATGGATCTAAACCAGCAGATGCAATCTCCACTACA
rJMSF017K15+ TCTGTTAGTAACCTTACCTCGTCAGATGGATCTAAACCAGCAGATGCAATCTCCACTACA
                      ____________________________________________________________
consensus TCTGTTAGTAACCTTACCTCGTCAGATGGATCTAAACCAGCAGATGCAATCTCCACTACA
 
. : . : . : . : . : . :
rJMSF053K01+ CTCTGCTTTCTTCCTGTTCAAACGTTCATTTATATATGGTATCTTCTGCTGTTGATCATG
rJMSF017K15+ CTCTGCTTTCTTCCTGTTCAAACGTTCATTTATATATGGTATCTTCTGCTGTTGATCATG
                      ____________________________________________________________
consensus CTCTGCTTTCTTCCTGTTCAAACGTTCATTTATATATGGTATCTTCTGCTGTTGATCATG
 
. : . : . : . : . : . :
rJMSF053K01+ ACTGTTCTTATTGTCCTCTTCTGGCCAACATATGGGTTGCCTTTCTTGCACCACCTTAGT
rJMSF017K15+ ACTGTTCTTATTGTCCTCTTCTGGCCAACATATGGGTTGCCTTTCTTGCACCACCTTAGT
                      ____________________________________________________________
consensus ACTGTTCTTATTGTCCTCTTCTGGCCAACATATGGGTTGCCTTTCTTGCACCACCTTAGT
 
. : . : . : . : . : . :
rJMSF053K01+ GAATACACGAGAAGTCTAATTAGTTTGAGCATGTTTGGGGGTGGGGTTAAGGAGAAAAAT
rJMSF017K15+ GAATACACGAGAAGTCTAATTAGTTTGAGCATGTTTGGGGGTGGGGTTAAGGAGAAAAAT
                      ____________________________________________________________
consensus GAATACACGAGAAGTCTAATTAGTTTGAGCATGTTTGGGGGTGGGGTTAAGGAGAAAAAT
 
. : . : . : . : . : . :
rJMSF053K01+ GATGATGAAATATGTGAGTATGAGGAGGTTTGGGATGCTGAAGGGACAATGCACCTCATA
rJMSF017K15+ GATGATGAAATATGTGAGTATGAGGAGGTTTGGGATGCTGAAGGGACAATGCACCTCATA
                      ____________________________________________________________
consensus GATGATGAAATATGTGAGTATGAGGAGGTTTGGGATGCTGAAGGGACAATGCACCTCATA
 
. : . : . : . : . : . :
rJMSF053K01+ AGGAAAACCTCTAAGGCTCGTCCTACATACTCTAGTGAGTCTTCCTCGGAAAGAGGTAAT
rJMSF017K15+ AGGAAAACCTCTAAGGCTCGTCCTACATACTCTAGTGAGTCTTCCTCGGAAAGAGGTAAT
                      ____________________________________________________________
consensus AGGAAAACCTCTAAGGCTCGTCCTACATACTCTAGTGAGTCTTCCTCGGAAAGAGGTAAT
 
. : . : . : . : . : . :
rJMSF053K01+ GCTGTCATGCGTTCAGCTGCCAGAAAACAAAATGTAGAGATAGATATCACAATGCCTGCA
rJMSF017K15+ GCTGTCATGCGTTCAGCTGCCAGAAAACAAAATGTAGAGATAGATATCACAATGCCTGCA
                      ____________________________________________________________
consensus GCTGTCATGCGTTCAGCTGCCAGAAAACAAAATGTAGAGATAGATATCACAATGCCTGCA
 
. : . : . : . : . : . :
rJMSF053K01+ GATGCGGTGAAATTACCATCTCGGGCAAACAAATCAAAGATGAAGTTGGTGATCAGGCAA
rJMSF017K15+ GATGCGGTGAAATTACCATCTCGGGCAAACAAATCAAAGATGAAGTTGGTGATCAGGCAA
                      ____________________________________________________________
consensus GATGCGGTGAAATTACCATCTCGGGCAAACAAATCAAAGATGAAGTTGGTGATCAGGCAA
 
. : . : . : . : . : . :
rJMSF053K01+ CTATTGAGGGTATTTCGTACAATCTTTATAATTGCTGCCTTTAATGTCCCGCTATACATG
rJMSF017K15+ CTATTGAGGGTATTTCGTACAATCTTTATAATTGCTGCCTTTAATGTCCCGCTATACATG
                      ____________________________________________________________
consensus CTATTGAGGGTATTTCGTACAATCTTTATAATTGCTGCCTTTAATGTCCCGCTATACATG
 
. : . : . : . : . : . :
rJMSF053K01+ ATGCTGCTGTTCAAAGACTGGATCGACAAATGACACACGAGAAAGATGGTGCAGTTAATA
rJMSF017K15+ ATGCTGCTGTTCAAAGACTGGATCGACAAATGACACACGAGAAAGATGGTGCAGTTAATA
                      ____________________________________________________________
consensus ATGCTGCTGTTCAAAGACTGGATCGACAAATGACACACGAGAAAGATGGTGCAGTTAATA
 
. : . : . : . : . : . :
rJMSF053K01+ TCAGGTGAGGCAAGTTTGAGCATAGCTTTGGTGAATGTCACCTGTTAATGATGTAATAGT
rJMSF017K15+ TCAGGTGAGGCAAGTTTGAGCATAGCTTTGGTGAATGTCACCTGTTAATGTTGTAATAGT
                      ____________________________________________________________
consensus TCAGGTGAGGCAAGTTTGAGCATAGCTTTGGTGAATGTCACCTGTTAATGTTGTAATAGT
 
. : . : . : . : . : . :
rJMSF053K01+ CATGACCTGGTAATTGTTTGTGACAGTCCAACCAAAAATGAAAG
rJMSF017K15+ CATGA-CTGGTAATTGTTTGTGACAGTCCAACCAAAAATGAAAGTGAAAGGTGTAAGAGG
                      ____________________________________________________________
consensus CATGACCTGGTAATTGTTTGTGACAGTCCAACCAAAAATGAAAGTGAAAGGTGTAAGAGG