Previous Contig 011967:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF009J22Sequence308018632772011967 (2)gb:BT004169_16372670.004Arabidopsis thaliana clone RAFL15-21-D23 (R20819) unknown protein (At5g67350) mR
JMSF017I05Sequence735011967 (2)

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF009J22+ TACCA
                      ____________________________________________________________
consensus TACCA
 
. : . : . : . : . : . :
rJMSF009J22+ CCACACACCGTAAATCCGGAACCAGTTCCAATACTTTCAGCCCAGCCNGACGCCGCAGCT
rJMSF017I05+ GACGCCGCAGNT
                      ____________________________________________________________
consensus CCACACACCGTAAATCCGGAACCAGTTCCAATACTTTCAGCCCAGCCNGACGCCGCAGCT
 
. : . : . : . : . : . :
rJMSF009J22+ TCGATTCTCCAAGGCTCCACACGCCAATAACTACGCCCGCAATAATTCCACCCTCTGGAG
rJMSF017I05+ TCGATTNTCCAAGGCTCCACACGCCAATAACTACGCCCGCAATAATTCCACCCTCTGGAG
                      ____________________________________________________________
consensus TCGATTCTCCAAGGCTCCACACGCCAATAACTACGCCCGCAATAATTCCACCCTCTGGAG
 
. : . : . : . : . : . :
rJMSF009J22+ CCTCTTCCGCGTCGGCCTCGTTACAATGCCGGAAATCGGATCCCACAGTTTCAGAGCTCA
rJMSF017I05+ CCTCTTCCGCGTCGGCCTCGTTACAATGCCGGAAATCGGATCCCACAGTTTCAGAGCTCA
                      ____________________________________________________________
consensus CCTCTTCCGCGTCGGCCTCGTTACAATGCCGGAAATCGGATCCCACAGTTTCAGAGCTCA
 
. : . : . : . : . : . :
rJMSF009J22+ GAACAGAGACGACAACAACAACAACAACAACAATCGTAACAACATTGTCCGTAGCGGCAG
rJMSF017I05+ GAACAGAGACGACAACAACAACAACAACAACAATCGTAACAACATTGTCCGTAGCGGCAG
                      ____________________________________________________________
consensus GAACAGAGACGACAACAACAACAACAACAACAATCGTAACAACATTGTCCGTAGCGGCAG
 
. : . : . : . : . : . :
rJMSF009J22+ CAGCAGCAGCAGCATTGTAAGCAACTCCGACACCAAACCCAACATTACCCAGAAGCTGAA
rJMSF017I05+ CAGCAGCAGCAGCATTGTAAGCAACTCCGACACCAAACCCAACATTACCCAGAAGCTGAA
                      ____________________________________________________________
consensus CAGCAGCAGCAGCATTGTAAGCAACTCCGACACCAAACCCAACATTACCCAGAAGCTGAA
 
. : . : . : . : . : . :
rJMSF009J22+ GCAGAGATTTTCATTTTCAGACAAAAACCTCGTCTTTTTCGACACCTGCAAGTGCTCTTC
rJMSF017I05+ GCAGAGATTTTCATTTTCAGACAAAAACCTCGTCTTTTTCGACACCTGCAAGTGCTCTTC
                      ____________________________________________________________
consensus GCAGAGATTTTCATTTTCAGACAAAAACCTCGTCTTTTTCGACACCTGCAAGTGCTCTTC
 
. : . : . : . : . : . :
rJMSF009J22+ CAATTCCGTCCAAACAATCCCTTCAGCACCCGCCAAGAACCAAGACCAGAAGAAAAACAA
rJMSF017I05+ CAATTCCGTCCAAACAATCCCTTCAGCACCCGCCAAGAACCAAGACCAGAAGAAAAACAA
                      ____________________________________________________________
consensus CAATTCCGTCCAAACAATCCCTTCAGCACCCGCCAAGAACCAAGACCAGAAGAAAAACAA
 
. : . : . : . : . : . :
rJMSF009J22+ GGAACCCGTAGCTCAATCGGTTCCTGGGTGGCAGATTATCCGCAAGAAAAACACAAAACA
rJMSF017I05+ GGAACCCGTAGCTCAATCGGTTCCTGGGTGGCAGATTATCCGCAAGAAAAACACAAAACA
                      ____________________________________________________________
consensus GGAACCCGTAGCTCAATCGGTTCCTGGGTGGCAGATTATCCGCAAGAAAAACACAAAACA
 
. : . : . : . : . : . :
rJMSF009J22+ ACAACCAACAACAACAGGGAAGCAAACCATGTCACGTATCCGAACGTTTGAATGGTTAAA
rJMSF017I05+ ACAACCAACAACAACAGGGAAGCAAACCATGTCACGTATCCGAACGTTTGAATGGTTAAA
                      ____________________________________________________________
consensus ACAACCAACAACAACAGGGAAGCAAACCATGTCACGTATCCGAACGTTTGAATGGTTAAA
 
. : . : . : . : . : . :
rJMSF009J22+ ACAGCTTTCTCTAGAAGCTGAAGGTGCCGCCACAACCGTACCACTGAATAATTAAAACAG
rJMSF017I05+ ACAGCTTTCTCTAGAAGCTGAAGGTGCCGCCACAACCGTACCACTGAATAATTAAAACAG
                      ____________________________________________________________
consensus ACAGCTTTCTCTAGAAGCTGAAGGTGCCGCCACAACCGTACCACTGAATAATTAAAACAG
 
. : . : . : . : . : . :
rJMSF009J22+ CTTAATCATGCTTATGATTGTTGGATGCCTTAACTCCTTGGCTGTATTGTGTTCTGATTG
rJMSF017I05+ CTTAATCATGCTTATGATTGTTGGATGCCTTAACTCCTTGGCTGTATTGTGTTCTGATTG
                      ____________________________________________________________
consensus CTTAATCATGCTTATGATTGTTGGATGCCTTAACTCCTTGGCTGTATTGTGTTCTGATTG
 
. : . : . : . : . : . :
rJMSF009J22+ TTTTTAATTTCTTCTTTGTTCTCTATAGAAGCTAGATTGATTAATGGAGTAATTAATCAC
rJMSF017I05+ TTTTTAATTTCTTCTTTGTTCTCTATAGAAGCTAGATTGATTAATGGAGTAATTAATCAC
                      ____________________________________________________________
consensus TTTTTAATTTCTTCTTTGTTCTCTATAGAAGCTAGATTGATTAATGGAGTAATTAATCAC
 
. : . : . : . : . : . :
rJMSF009J22+ TGCTAAAATGAAGACTGATGTAATGACTTAATTGCGTAGCACCTATG
rJMSF017I05+ TGCTAAAATGAAGACTGATGTAATGACTTAATTGCGTAGCACCTATGTTCCCTGTAGCTG
                      ____________________________________________________________
consensus TGCTAAAATGAAGACTGATGTAATGACTTAATTGCGTAGCACCTATGTTCCCTGTAGCTG