Previous Contig 011961:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF017H13Sequence586005687 (3)gb:AB012239_15116639e-17Arabidopsis thaliana genomic DNA, chromosome 5, TAC clone:K11J9.741011961 (2)gb:AB023044_15155022e-62Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MWD22.
JMSF034N11Sequence653005687 (3)gb:AB012239_15116631e-27Arabidopsis thaliana genomic DNA, chromosome 5, TAC clone:K11J9.724011961 (2)gb:AB023044_15155021e-59Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MWD22.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF034N11+ GAAC
rJMSF017H13+ GGAAACGGGCCCCGTTGGAAC
                      ____________________________________________________________
consensus GGAAACGGGCCCCGTTGGAAC
 
. : . : . : . : . : . :
rJMSF034N11+ NGTCTGCTATATAGATCCCGAGTATACAAGGACTGGCTTGATCTCTCCAAAGTCCGATGT
rJMSF017H13+ GGTCTGCTATATAGATCCCGAGTATACAAGGACTGGCTTGATCTCTCCAAAGTCCGATGT
                      ____________________________________________________________
consensus GGTCTGCTATATAGATCCCGAGTATACAAGGACTGGCTTGATCTCTCCAAAGTCCGATGT
 
. : . : . : . : . : . :
rJMSF034N11+ TTATGCACTCGGAATGGTTATTCTGCAGCTGTTGACAGCAAAACAGGCCATCGGACTAAC
rJMSF017H13+ TTATGCACTCGGAATGGTTATTCTGCAGCTGTTGACAGCAAAACAGGCCATCGGACTAAC
                      ____________________________________________________________
consensus TTATGCACTCGGAATGGTTATTCTGCAGCTGTTGACAGCAAAACAGGCCATCGGACTAAC
 
. : . : . : . : . : . :
rJMSF034N11+ ACACATTGTCGAAACTGCTATTGACATTGATACCCTCGAGGAGATACTTGACACCGAGGC
rJMSF017H13+ ACACATTGTCGAAACTGCTATTGACATTGATACCCTCGAGGAGATACTTGACACCGAGGC
                      ____________________________________________________________
consensus ACACATTGTCGAAACTGCTATTGACATTGATACCCTCGAGGAGATACTTGACACCGAGGC
 
. : . : . : . : . : . :
rJMSF034N11+ TGGTAAATGGCCACGAGAAGAGACAAAGGAATTGGCAGTACTAGCTCTAAGATGCACAGA
rJMSF017H13+ TGGTAAATGGCCACGAGAAGAGACAAAGGAATTGGCAGTACTAGCTCTAAGATGCACAGA
                      ____________________________________________________________
consensus TGGTAAATGGCCACGAGAAGAGACAAAGGAATTGGCAGTACTAGCTCTAAGATGCACAGA
 
. : . : . : . : . : . :
rJMSF034N11+ GCTTAAGCGAAAGGATAGACCCGACCTGAAGGATCATATACTCCCGGTTCTCGAGAAGCT
rJMSF017H13+ GCTTAAGCGAAAGGATAGACCCGACCTGAAGGATCATATACTCCCGGTTCTCGAGAAGCT
                      ____________________________________________________________
consensus GCTTAAGCGAAAGGATAGACCCGACCTGAAGGATCATATACTCCCGGTTCTCGAGAAGCT
 
. : . : . : . : . : . :
rJMSF034N11+ GAAAGATGTAGCAAATCAAGCTAAAGAAATGGCATCAATCGCCCCGCCCCCTCCACCTAA
rJMSF017H13+ GAAAGATGTAGCAAATCAAGCTAAAGAAATGGCATCAATCGCCCCGCCCCCTCCACCTAA
                      ____________________________________________________________
consensus GAAAGATGTAGCAAATCAAGCTAAAGAAATGGCATCAATCGCCCCGCCCCCTCCACCTAA
 
. : . : . : . : . : . :
rJMSF034N11+ CTACTTCATGTGCCCCATTCTCAAGGATGTAATGGAGGATCCTTGTGTTGCAGCCGATGG
rJMSF017H13+ CTACTTCATGTGCCCCATTCTCAAGGATGTAATGGAGGATCCTTGTGTTGCAGCCGATGG
                      ____________________________________________________________
consensus CTACTTCATGTGCCCCATTCTCAAGGATGTAATGGAGGATCCTTGTGTTGCAGCCGATGG
 
. : . : . : . : . : . :
rJMSF034N11+ GTATACCTATGACCGGAAGGCGATAGAAAGTTGGCTAAACGAGAACGAGAATTCACCAAT
rJMSF017H13+ GTATACCTATGACCGGAAGGCGATAGAAAGTTGGCTAAACGAGAACGAGAATTCACCAAT
                      ____________________________________________________________
consensus GTATACCTATGACCGGAAGGCGATAGAAAGTTGGCTAAACGAGAACGAGAATTCACCAAT
 
. : . : . : . : . : . :
rJMSF034N11+ GACAAACCTACCATTACCTCACAAGAACCTTCTACCAAACTACACGATTCTTTCTGCAAT
rJMSF017H13+ GACAAACCTACCATTACCTCACAAGAACCTTCTACCAAACTACACGATTCTTTCTGCAAT
                      ____________________________________________________________
consensus GACAAACCTACCATTACCTCACAAGAACCTTCTACCAAACTACACGATTCTTTCTGCAAT
 
. : . : . : . : . : . :
rJMSF034N11+ TACAGTGTGGAAGTCTGGTAAGCAATAACTCAGATCTCTCAGATTGTCTATATAGGTGTC
rJMSF017H13+ TACAGTGTGGAAGTCTGGTAAGCAATAACTCAGATCTCTCAGATTGTCTATATAGGTGTC
                      ____________________________________________________________
consensus TACAGTGTGGAAGTCTGGTAAGCAATAACTCAGATCTCTCAGATTGTCTATATAGGTGTC
 
. : . : . : . : . : . :
rJMSF034N11+ TCTTCTAGTTCTAGATAGTGACTTTTAGGGACTGCTGTGCCTTGCAGACATTTGTTTTTG
rJMSF017H13+ TCTTCTAGTTCTAGATAGTGACTTTTAGGGACTGCTGTGCCTTGCAGACATTTGTTTTTG
                      ____________________________________________________________
consensus TCTTCTAGTTCTAGATAGTGACTTTTAGGGACTGCTGTGCCTTGCAGACATTTGTTTTTG
 
. : . : . : . : . : . :
rJMSF034N11+ CCATTAGATTTTCAGATCCATCAATGTCAAATGCTGATGAACTGTAAAGTTGAC
rJMSF017H13+ CCATTAGATTTTCAGATCCATCAATGTCAAATGCTGATGAACTGTAAAGTTGACAGATTG
                      ____________________________________________________________
consensus CCATTAGATTTTCAGATCCATCAATGTCAAATGCTGATGAACTGTAAAGTTGACAGATTG