Previous Contig 011960:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF017H10Sequence582011960 (3)gb:AF403707_17965497e-24Malus x domestica glutathione peroxidase mRNA, complete cds.759011960 (3)gb:AY086991_15720273e-69Arabidopsis thaliana clone 30238 mRNA, complete sequence.>gb:BT003059_1636641 Ar
JMSF018H10Sequence534011960 (3)sp|O23970|GPX1_HELAN6e-58Glutathione peroxidase 1 (EC 1.11.1.9).>pir|T14262|T14262 glutathione peroxidase

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF017H10- GGACATTTCTGAGCTCCAACGCAATTGAAAATTGAGATGG
                      ____________________________________________________________
consensus GGACATTTCTGAGCTCCAACGCAATTGAAAATTGAGATGG
 
. : . : . : . : . : . :
JMSF017H10- CAAGCGATTTGACCAAACTTTCTGAATCTGTCTACGACTTCATCGTTAAGGGAAAAATTC
                      ____________________________________________________________
consensus CAAGCGATTTGACCAAACTTTCTGAATCTGTCTACGACTTCATCGTTAAGGGAAAAATTC
 
. : . : . : . : . : . :
JMSF017H10- TTACTGACGATATCATTAGAAACTGGACCATTTTTATTGCTTGCTACAACAAACAATTGA
                      ____________________________________________________________
consensus TTACTGACGATATCATTAGAAACTGGACCATTTTTATTGCTTGCTACAACAAACAATTGA
 
. : . : . : . : . : . :
JMSF017H10- ACTGGGGAAGCGTAATCACATAATCATTAATCAAGAAATGTCTTTCTTTTAACTTAAGAC
                      ____________________________________________________________
consensus ACTGGGGAAGCGTAATCACATAATCATTAATCAAGAAATGTCTTTCTTTTAACTTAAGAC
 
. : . : . : . : . : . :
JMSF017H10- AGCAACAAAATGAAGAATTATAGATTTTGGTTGCATATATTTACCCTTGTTTGTTTTGAC
                      ____________________________________________________________
consensus AGCAACAAAATGAAGAATTATAGATTTTGGTTGCATATATTTACCCTTGTTTGTTTTGAC
 
. : . : . : . : . : . :
JMSF017H10- AGTCTGATGGATGTTCTGCAGCTACAGAATAAGTGTTTTTAGTTTCATCATGTCTTTGAC
rJMSF017H10+ CTACAGAATAAGTGTTTTTAGTTTCATCATGTCTTNGAC
                      ____________________________________________________________
consensus AGTCTGATGGATGTTCTGCAGCTACAGAATAAGTGTTTTTAGTTTCATCATGTCTTTGAC
 
. : . : . : . : . : . :
JMSF017H10- TACTTAGCTTAGGGAGGGAAATAATGCAGCAGGTGATGGATGGGTAGTGTTATTTTGCAG
rJMSF018H10+ CAG
rJMSF017H10+ TACTTAGCNTAGGGAGGGAAATAATGCAGCAGGTGATGGATGGGTAGTGTTATTTTGCAG
                      ____________________________________________________________
consensus TACTTAGCTTAGGGAGGGAAATAATGCAGCAGGTGATGGATGGGTAGTGTTATTTTGCAG
 
. : . : . : . : . : . :
JMSF017H10- GATGCGAAAGGCAACGATGTAGATCTCAACATCTATAAGGGAAAAGTCCTCCTAATTGTC
rJMSF018H10+ GATGNGAAAGGCANNGATGTAGATCTCAACATCTATAAGGGAAAAGTCGTCCTAANGGTC
rJMSF017H10+ GATGCGAAAGGCAACGATGTAGATCTCAACATCTATAAGGGAAAAGTCCTCCTAATTGTC
                      ____________________________________________________________
consensus GATGCGAAAGGCAACGATGTAGATCTCAACATCTATAAGGGAAAAGTCCTCCTAATTGTC
 
. : . : . : . : . : . :
JMSF017H10- AATGTTGCTTCCAAGTGTGGGATGACGAACTCAAACTACACTGAGCTCAATCAATTGTAC
rJMSF018H10+ AATGTTGCTTCCAAGTGTGGGATGANGNACTCAAAATACNCNGAGCTCNATCAATTGTAC
rJMSF017H10+ AATGTTGCTTCCAAGTGTGGGATGACGAACTCAAACTACACTGAGCTCAATCAATTGTAC
                      ____________________________________________________________
consensus AATGTTGCTTCCAAGTGTGGGATGACGAACTCAAACTACACTGAGCTCAATCAATTGTAC
 
. : . : . : . : . : . :
JMSF017H10- GAGAAGTACAGACACCAAGGCCTGGAAATACTAGCATTTCCCTGCAATCAGTTTGGAGAG
rJMSF018H10+ GAGAAGTACAGACACCAAGGCCTGGAAATCCTAGCANTTCCCTGCAATCAGTTNGGAGAG
rJMSF017H10+ GAGAAGTACAGACACCAAGGCCTGGAAATACTAGCATTTCCCTGCAATCAGTTTGGAGAG
                      ____________________________________________________________
consensus GAGAAGTACAGACACCAAGGCCTGGAAATACTAGCATTTCCCTGCAATCAGTTTGGAGAG
 
. : . : . : . : . : . :
JMSF017H10- GA
rJMSF018H10+ GAGGAACCAGGAAGCAATGNTCAGATATTAGATNNNGTTTGCACTCGTTTCAAGTCAGAG
rJMSF017H10+ GAGGAACCAGGAAGCAATGATCAGATATTAGATTTTGTTTGCACTCGTTTCAAGTCAGAG
                      ____________________________________________________________
consensus GAGGAACCAGGAAGCAATGATCAGATATTAGATTTTGTTTGCACTCGTTTCAAGTCAGAG
 
. : . : . : . : . : . :
rJMSF018H10+ TTNCCCGTNNTTGGCAAGANTGAAGTGAATGGTGAAAATGCTTCTCCCCTTTATAAGTAT
rJMSF017H10+ TTCCCCGTCTTTGGCAAGATTGAAGTGAATGGTGAAAATGCTTCTCCCCTTTATAAGTAT
                      ____________________________________________________________
consensus TTCCCCGTCTTTGGCAAGATTGAAGTGAATGGTGAAAATGCTTCTCCCCTTTATAAGTAT
 
. : . : . : . : . : . :
rJMSF018H10+ ATGAAATTAGGGAAGTGGGGAATATTTGGAGATGACATTCAGTGGAACTTTGCAAAGTTT
rJMSF017H10+ ATGAAATTAGGGAAGTGGGGAATATTTGGAGATGACATTCAGTGGAACTTTGCAAAGTTT
                      ____________________________________________________________
consensus ATGAAATTAGGGAAGTGGGGAATATTTGGAGATGACATTCAGTGGAACTTTGCAAAGTTT
 
. : . : . : . : . : . :
rJMSF018H10+ CTGGTTGATCAGAGAGGGCAGCCTGTCGATNGNTATTATCCCACAACATCACCCCTTACC
rJMSF017H10+ CTGGTTGATCAGAGAGGGCAGCCTGTCGATCGCTATTATCCCACAACATCACCCCTTACC
                      ____________________________________________________________
consensus CTGGTTGATCAGAGAGGGCAGCCTGTCGATCGCTATTATCCCACAACATCACCCCTTACC
 
. : . : . : . : . : . :
rJMSF018H10+ ATTGAGAGAGATGTACAGAAACTACTAGGAAAAAAGGAATAGNGTGNTCTNNGTGCTACT
rJMSF017H10+ ATTGAGAGAGATGTACAGAAACTACTAGGAAAAAAGGAATAGTGTGATCTATGTGCTACT
                      ____________________________________________________________
consensus ATTGAGAGAGATGTACAGAAACTACTAGGAAAAAAGGAATAGTGTGATCTATGTGCTACT
 
. : . : . : . : . : . :
rJMSF018H10+ CACTCACTTTCATGGAAATCTTAGT
rJMSF017H10+ CACTCACTTTCATGGAAATCTTAGTATTCATTCTCCATCAGATTGGTGGTATAAATGCTC
                      ____________________________________________________________
consensus CACTCACTTTCATGGAAATCTTAGTATTCATTCTCCATCAGATTGGTGGTATAAATGCTC
 
. : . : . : . : . : . :
rJMSF017H10+ TAATCTATACAACACTAGCAGTGCATCAAAATCACAAATCAAATGTTCTTCTGGATTGGA
                      ____________________________________________________________
consensus TAATCTATACAACACTAGCAGTGCATCAAAATCACAAATCAAATGTTCTTCTGGATTGGA
 
. : . : . : . : . : . :
rJMSF017H10+ TTTGCAAAATCTTCTTGGTTTCTTTGTGTATTGTGACAGGCAAGTGATGTTTTAATGTAC
                      ____________________________________________________________
consensus TTTGCAAAATCTTCTTGGTTTCTTTGTGTATTGTGACAGGCAAGTGATGTTTTAATGTAC