Previous Contig 011951:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF026A21Sequence576001232 (5)gb:AC005167_15322283e-38Arabidopsis thaliana chromosome 2 clone F12A24 map mi398, complete sequence.>gb:755011951 (4)gb:AP003872_18346062e-55Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC clone:OJ11
JMFF046K18Sequence548001232 (5)gb:AP003872_18346061e-32Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC clone:OJ11503011951 (4)gb:AY048281_15617423e-46Arabidopsis thaliana AT5g15220/F8M21_110 mRNA, complete cds.>gb:AY079120_1568181
JMSF017E21Sequence208005674 (3)750011951 (4)gb:AP003872_18346062e-55Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC clone:OJ11
JMSF051M09Sequence642020585713011951 (4)gb:AP003872_18346061e-55Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC clone:OJ11

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF017E21+ GTCGCCACCGCCCACCAGACACCACACGGC
                      ____________________________________________________________
consensus GTCGCCACCGCCCACCAGACACCACACGGC
 
. : . : . : . : . : . :
rJMSF017E21+ CGCACCAGTCGCCGACTAGCAGCCGTTCGTTTCAACCGTACTCCTCTGCTTCAACCGTCG
                      ____________________________________________________________
consensus CGCACCAGTCGCCGACTAGCAGCCGTTCGTTTCAACCGTACTCCTCTGCTTCAACCGTCG
 
. : . : . : . : . : . :
rJMSF051M09+ GGAGTCATGAATTTCACAACACTGTTTAGGAGGTTGAATATCAGAGAGTTGG
rJMFF026A21+ GGAGTCATGAATTTCACAACACTGTTTAGGAGGTTGAATATCAGAGAGTTGG
rJMSF017E21+ CCACACCAGGAGTCATGAATTTCACAACACTGTTTAGGAGGTTGAATATCAGAGAGTTGG
                      ____________________________________________________________
consensus CCACACCAGGAGTCATGAATTTCACAACACTGTTTAGGAGGTTGAATATCAGAGAGTTGG
 
. : . : . : . : . : . :
rJMSF051M09+ TATCAAATGCACCAGTATACAGTTCTGGTAGCGATGCATCTGGGGAGGGATTGAGCTTAG
rJMFF026A21+ TATCAAATGCACCAGTATACAGTTCTGGTAGCGATGCATCTGGGGAGGGATTGAGCTTAG
rJMSF017E21+ TATCAAATGCACCAGTATACAGTTCTGGTAGCGATGCATCTGGGGAGGGATTGAGCTTAG
                      ____________________________________________________________
consensus TATCAAATGCACCAGTATACAGTTCTGGTAGCGATGCATCTGGGGAGGGATTGAGCTTAG
 
. : . : . : . : . : . :
rJMSF051M09+ TACTCCGGCGCTGGGCGACCAAAAAGACAGCGGGATCCACAAAAAATGGACGTGACTCAA
rJMFF026A21+ TACTCCGGCGCTGGGCGACCAAAAAGACAGCGGGATCCACAAAAAATGGACGTGACTCAA
rJMFF046K18+ GGCGCTGGGCGACCAAAAAGACAGCGGGATCCACAAAAAATGGACGTGACTCAA
rJMSF017E21+ TACTCCGGCGCTGGGCGACCAAAAAGACAGCGGGATCCACAAAAAATGGACGTGACTCAA
                      ____________________________________________________________
consensus TACTCCGGCGCTGGGCGACCAAAAAGACAGCGGGATCCACAAAAAATGGACGTGACTCAA
 
. : . : . : . : . : . :
rJMSF051M09+ AGCCCAAGAATCTTGGAGTAAAGAAATTCGGTGGAGAGAGGGTGATCCCTGGAAATATCA
rJMFF026A21+ AGCCCAAGAATCTTGGAGTAAAGAAATTCGGTGGAGAGAGGGTGATCCCTGGAAATATCA
rJMFF046K18+ AGCCCAAGAATCTTGGAGTAAAGAAATTCGGTGGAGAGAGGGTGATCCCTGGAAATATCA
rJMSF017E21+ AGCCCAAGAATCTTGGAGTAAAGAAATTCGGTGGAGAGAGGGTGATCCCTGGAAATATCA
                      ____________________________________________________________
consensus AGCCCAAGAATCTTGGAGTAAAGAAATTCGGTGGAGAGAGGGTGATCCCTGGAAATATCA
 
. : . : . : . : . : . :
rJMSF051M09+ TTGTTCGCCAAAGAGGAACCCGATTTCATCCCGGGGATTACGTTGGAATTGGTAAAGATC
rJMFF026A21+ TTGTTCGCCAAAGAGGAACCCGATTTCATCCCGGGGATTACGTTGGAATTGGTAAAGATC
rJMFF046K18+ TTGTTCGCCAAAGAGGAACCCGATTTCATCCCGGGGATTACGTTGGAATTGGTAAAGATC
rJMSF017E21+ TTGTTCGCCAAAGAGGAACCCGATTTCATCCCGGGGATTACGTTGGAATTGGTAAAGATC
                      ____________________________________________________________
consensus TTGTTCGCCAAAGAGGAACCCGATTTCATCCCGGGGATTACGTTGGAATTGGTAAAGATC
 
. : . : . : . : . : . :
rJMSF051M09+ ACACCCTTTATGCTTTAAAAGAAGGGTGTGTCAAGTTTGAGCGTAACAAGCTGACTGGAC
rJMFF026A21+ ACACCCTTTATGCTTTAAAAGAAGGGTGTGTCAAGTTTGAGCGTAACAAGCTGACTGGAC
rJMFF046K18+ ACACCCTTTATGCTTTAAAAGAAGGGTGTGTCAAGTTTGAGCGTAACAAGCTGACTGGAC
rJMSF017E21+ ACACCCTTTATGCTTTAAAAGAAGGGTGTGTCAAGTTTGAGCGTAACAAGCTGACTGGAC
                      ____________________________________________________________
consensus ACACCCTTTATGCTTTAAAAGAAGGGTGTGTCAAGTTTGAGCGTAACAAGCTGACTGGAC
 
. : . : . : . : . : . :
rJMSF051M09+ GTAAGTGGGTGCATGTTGAGCCCAAAGATGGTCATGTACTTCACCCAATATATTCGACTG
rJMFF026A21+ GTAAGTGGGTGCATGTTGAGCCCAAAGATGGTCATGTACTTCACCCAATATATTCGACTG
rJMFF046K18+ GTAAGTGGGTGCATGTTGAGCCCAAAGATGGTCATGTACTTCACCCAATATATTCGACTG
rJMSF017E21+ GTAAGTGGGTGCATGTTGAGCCCAAAGATGGTCATGTACTTCACCCAATATATTCGACTG
                      ____________________________________________________________
consensus GTAAGTGGGTGCATGTTGAGCCCAAAGATGGTCATGTACTTCACCCAATATATTCGACTG
 
. : . : . : . : . : . :
rJMSF051M09+ CTGCAGATCCCGAGCTGAAGACTGCTACTTAGATTTTGCTTCCTCCAATTTTAAATCACT
rJMFF026A21+ CTGCAGATCCCGAGCTGAAGACTGCTACTTAGATTTTGCTTCCTCCAATTTTAAATCACT
rJMFF046K18+ CTGCAGATCCCGAGCTGAAGACTGCTACTTAGATTTTGCTTCCTCCAATTTTAAATCACT
rJMSF017E21+ CTGCAGATCCCGAGCTGAAGACTGCTACTTAGATTTTGCTTCCTCCAATTTTAAATCACT
                      ____________________________________________________________
consensus CTGCAGATCCCGAGCTGAAGACTGCTACTTAGATTTTGCTTCCTCCAATTTTAAATCACT
 
. : . : . : . : . : . :
rJMSF051M09+ TATCTCGAACTATGGAGTAACCATCTATAAGTTTTGAATTCTTGTTTCCATTTATTCAAG
rJMFF026A21+ TA
rJMFF046K18+ TA
rJMSF017E21+ TATCTCGAACTATGGAGTAACCATCTATAAGTTTTGAATTCTTGTTTCCATTTATTCAAG
                      ____________________________________________________________
consensus TATCTCGAACTATGGAGTAACCATCTATAAGTTTTGAATTCTTGTTTCCATTTATTCAAG
 
. : . : . : . : . : . :
rJMSF051M09+ GCGCTAGATACACTTTCTGTACTTC
rJMSF017E21+ GCGCTAGATACACTTTCTGTACTTCACTTGGCCTCTTTATGACAGACATTTTTGTTAGTA
                      ____________________________________________________________
consensus GCGCTAGATACACTTTCTGTACTTCACTTGGCCTCTTTATGACAGACATTTTTGTTAGTA
 
. : . : . : . : . : . :
rJMSF017E21+ ATAATAGTCATCTTTTCTCTTTGGTTGCTATATTTTGTAATTCAAAATGAATACACTCAC
                      ____________________________________________________________
consensus ATAATAGTCATCTTTTCTCTTTGGTTGCTATATTTTGTAATTCAAAATGAATACACTCAC