Previous Contig 011945:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF018N10Sequence553005670 (14)pir|D86266|D862661e-31hypothetical protein F3F19.22 - Arabidopsis thaliana>gb:AE005172_890331 Arabidop700011945 (3)pir|T06696|T066962e-15lipase homolog T29H11.20 - Arabidopsis thaliana>gb:ATT29H11_1555658 Arabidopsis
JMSF017D08Sequence522005670 (14)pir|D86266|D862667e-17hypothetical protein F3F19.22 - Arabidopsis thaliana>gb:AE005172_890331 Arabidop749011945 (3)pir|T06696|T066964e-20lipase homolog T29H11.20 - Arabidopsis thaliana>gb:ATT29H11_1555658 Arabidopsis
JMSF046N24Sequence732005670 (14)pir|E86378|E863786e-58protein F21J9.10 [imported] - Arabidopsis thaliana>gb:AE005172_891397 Arabidopsi602011945 (3)pir|T06696|T066968e-14lipase homolog T29H11.20 - Arabidopsis thaliana>gb:ATT29H11_1555658 Arabidopsis

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF017D08+ CTGTGTGAGCCACTTCTGAGCAATAGATGTA
                      ____________________________________________________________
consensus CTGTGTGAGCCACTTCTGAGCAATAGATGTA
 
. : . : . : . : . : . :
rJMFF018N10+ CTGAACATTATAGTAGTCACTGATGCCGATTGGACCGACCCAGAAAGAGTGCATTCTT
rJMSF017D08+ CCCTGAACATTATAGTAGTCACTGATGCCGATTGGACCGACCCAG-AAGAGTGCATTCTT
                      ____________________________________________________________
consensus CCCTGAACATTATAGTAGTCACTGATGCCGATTGGACCGACCCAGAAAGAGTGCATTCTT
 
. : . : . : . : . : . :
rJMFF018N10+ GAACTCTTCTATGCAACGGTGGGCGTGTTTACCCATGCAATTCTTTTCTCTGAGGAAATT
rJMSF046N24+ TGAGGAAATT
rJMSF017D08+ GAACTCTTCTATGCAACGGTGGGCGTGTTTACCCATGCAATTCTTTTCTCTGAGGAAATT
                      ____________________________________________________________
consensus GAACTCTTCTATGCAACGGTGGGCGTGTTTACCCATGCAATTCTTTTCTCTGAGGAAATT
 
. : . : . : . : . : . :
rJMFF018N10+ TCTGAACCAGTGTACCTGTGTCTGAATGGTCATAGGTATGCCTTTCCAGATTACGTGTGA
rJMSF046N24+ TCTGAACCAGTGTACCTGTGTCTGAATGGTCATAGGTATGCCTTTCCAGATTACGTGTGA
rJMSF017D08+ TCTGAACCAGTGTACCTGTGTCTGAATGGTCATAGGTATGCCTTTCCAGATTACGTGTGA
                      ____________________________________________________________
consensus TCTGAACCAGTGTACCTGTGTCTGAATGGTCATAGGTATGCCTTTCCAGATTACGTGTGA
 
. : . : . : . : . : . :
rJMFF018N10+ GAGGTCTTGATTTGTGAAGTATTTGTGCTGGAGAGACGAGGATCCGGCGATTGCAAAGTT
rJMSF046N24+ GAGGTCTTGATTTGTGAAGTATTTGTGCTGGAGAGACGAGGATCCGGCGATTGCAAAGTT
rJMSF017D08+ GAGGTCTTGATTTGTGAAGTATTTGTGCTGGAGAGACGAGGATCCGGCGATTGCAAAGTT
                      ____________________________________________________________
consensus GAGGTCTTGATTTGTGAAGTATTTGTGCTGGAGAGACGAGGATCCGGCGATTGCAAAGTT
 
. : . : . : . : . : . :
rJMFF018N10+ GACACCGGATGTGGCTGTGGATAAGGCCCCGGGGGTGGCGGAGTAGCTGTTTTTGGAAAT
rJMSF046N24+ GACACCGGATGTGGCTGTGGATAAGGCCCCGGGGGTGGCGGAGTAGCTGTTTTTGGAAAT
rJMSF017D08+ GACACCGGATGTGGCTGTGGATAAGGCCCCGGGGGTGGCGGAGTAGCTGTTTTTGGAAAT
                      ____________________________________________________________
consensus GACACCGGATGTGGCTGTGGATAAGGCCCCGGGGGTGGCGGAGTAGCTGTTTTTGGAAAT
 
. : . : . : . : . : . :
rJMFF018N10+ GTTTAGCCAAGGCTGTGGGGATGGCAAAGAGAAGGATGCAGACACATAGTCCACCGCCAA
rJMSF046N24+ GTTTAGCCAAGGCTGTGGGGATGGCAAAGAGAAGGATGCAGACACATAGTCCACCGCCAA
rJMSF017D08+ GTTTAGCCAAGGCTGTGGGGATGGCAAAGAGAAGGATGCAGACACATAGTCCACCGCCAA
                      ____________________________________________________________
consensus GTTTAGCCAAGGCTGTGGGGATGGCAAAGAGAAGGATGCAGACACATAGTCCACCGCCAA
 
. : . : . : . : . : . :
rJMFF018N10+ TTTACCGTTGGATAATCGGCCTCCAGAGCGCTGGCAGTTAGCACCAAAGCTTCCTTTAAG
rJMSF046N24+ TTTACCGTTGGATAATCGGCCTCCAGAGCGCTGGCAGTTAGCACCAAAGCTTCCTTTAAG
rJMSF017D08+ TTTACCGTTGGATAATCGGCCTCCAGAGCGCTGGCAGTTAGCACCAAAGCTTCCTTTAAG
                      ____________________________________________________________
consensus TTTACCGTTGGATAATCGGCCTCCAGAGCGCTGGCAGTTAGCACCAAAGCTTCCTTTAAG
 
. : . : . : . : . : . :
rJMFF018N10+ GCTTGTCATTGTGCAAGCATTTCCGGTGTCTGTGTATGAGCCCCCGAAGGCATACACCGC
rJMSF046N24+ GCTTGTCATTGTGCAAGCATTTCCGGTGTCTGTGTATGAGCCCCCGAAGGCATACACCGC
rJMSF017D08+ GCTTGTCATTGTGCAAGCATTTCCGGTGTCTGTGTATGAGCCCCCGAAGGCATACACCGC
                      ____________________________________________________________
consensus GCTTGTCATTGTGCAAGCATTTCCGGTGTCTGTGTATGAGCCCCCGAAGGCATACACCGC
 
. : . : . : . : . : . :
rJMFF018N10+ GGAGAAGGTGCTGCCATGTTTCCCCTGCAAACTCCCGCTTTCTTGGGCATAGACAACACG
rJMSF046N24+ GGAGAAGGTGCTGCCATGTTTCCCCTGCAAACTCCCGCTTTCTTGGGCATAGACAACACG
rJMSF017D08+ GGAGAAGGTGCTGCCATGTTTCCCCTGCAAACTCCCGCTTTCTTGGGCATAGACAACACG
                      ____________________________________________________________
consensus GGAGAAGGTGCTGCCATGTTTCCCCTGCAAACTCCCGCTTTCTTGGGCATAGACAACACG
 
. : . : . : . : . : . :
rJMFF018N10+ AGCATATGTTGAGAAGAAGAACAAGAAGGATGTTATGAAGGAGAGGGTAAGAGAAGAGGA
rJMSF046N24+ AGCATATGTTGAGAAGAAGAACAAGAAGGATGTTATGAAGGAGAGGGTAAGAGAAGAGGA
rJMSF017D08+ AGCATATGTTGAGAAGAAGAACAAGAAGGATGTTATGAAGGAGAGGGTAAGAGAAGAGGA
                      ____________________________________________________________
consensus AGCATATGTTGAGAAGAAGAACAAGAAGGATGTTATGAAGGAGAGGGTAAGAGAAGAGGA
 
. : . : . : . : . : . :
rJMFF018N10+ AGACATGTTTTGCATGAAATTAAATTTTTTTTTGATGTTTTTGTATTCAAGAAATGCTGC
rJMSF046N24+ AGACATGGTTTGCATGAAATTAAATTTTTTTTTGATGTTTTTGTATTCAAGAAATGCTGC
rJMSF017D08+ AGACATGGTTTGCATGAAATTAAATTTTTTTTTGATGTTTTTGTATTCAAGAAATGCTGC
                      ____________________________________________________________
consensus AGACATGGTTTGCATGAAATTAAATTTTTTTTTGATGTTTTTGTATTCAAGAAATGCTGC
 
. : . : . : . : . : . :
rJMFF018N10+ ACAAATGTTATTTATGCATTATTACCATTGGAGCAC
rJMSF046N24+ ACAAATGTTATTTATGCATTATTACCATTGGAGCACCAGGATTTAGATGAGT
rJMSF017D08+ ACAAATGTTATTTATGCATTATTACCATTGGAGCA-CAGGATTTAGATGAGTGGACACCC
                      ____________________________________________________________
consensus ACAAATGTTATTTATGCATTATTACCATTGGAGCACCAGGATTTAGATGAGTGGACACCC