Previous Contig 011941:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF013B04Sequence291005366 (2)pir|B86392|B863924e-06T1K7.11 protein - Arabidopsis thaliana>gb:AE005172_891526 Arabidopsis thaliana c780011941 (2)pir|B86392|B863923e-56T1K7.11 protein - Arabidopsis thaliana>gb:AE005172_891526 Arabidopsis thaliana c
JMSF017C11Sequence457005366 (2)gb:AP003840_18340482e-38Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC clone:OJ16731011941 (2)pir|B86392|B863927e-35T1K7.11 protein - Arabidopsis thaliana>gb:AE005172_891526 Arabidopsis thaliana c

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF013B04+ ACCNTGGATCATCTTCATTTCCAGAAGCATACTTGCAAA
                      ____________________________________________________________
consensus ACCNTGGATCATCTTCATTTCCAGAAGCATACTTGCAAA
 
. : . : . : . : . : . :
rJMSF013B04+ TAGCATATGCGGATGTTGTGATTCTTAACAAGATTGATCTGGTATCTCAAGATGGTTCTG
rJMSF017C11+ AAGATGGTTCTG
                      ____________________________________________________________
consensus TAGCATATGCGGATGTTGTGATTCTTAACAAGATTGATCTGGTATCTCAAGATGGTTCTG
 
. : . : . : . : . : . :
rJMSF013B04+ GATCAGCTCTAGATGAACTGGAGAAGGAGATACACAATATTAATT-CCCTTGCCAATATT
rJMSF017C11+ GATCAGCTCTAGATGANCTGGAGAAGGAGATACACAATATTAATTCCCCTTGCCAATATT
                      ____________________________________________________________
consensus GATCAGCTCTAGATGAACTGGAGAAGGAGATACACAATATTAATTCCCCTTGCCAATATT
 
. : . : . : . : . : . :
rJMSF013B04+ ATTCATTCTGTTCGTTGTCAAGTTGACTTGTCTAAAATACTGAATTGCCAAGCATATGAT
rJMSF017C11+ ATTCATTCTGTTCGTTGTCAAGTTGACTTGTCTAAAATACTGAATTGCCAAGCATATGAT
                      ____________________________________________________________
consensus ATTCATTCTGTTCGTTGTCAAGTTGACTTGTCTAAAATACTGAATTGCCAAGCATATGAT
 
. : . : . : . : . : . :
rJMSF013B04+ CCAACACATGTAACTCACTTGGAAGCATTGCTAGAAGCAAATAAATCTCTAACTACTCGA
rJMSF017C11+ CCAACACATGTAACTCACTTGGAAGCATTGCTAGAAGC-AATAAATCTCTAACTACTCGA
                      ____________________________________________________________
consensus CCAACACATGTAACTCACTTGGAAGCATTGCTAGAAGCAAATAAATCTCTAACTACTCGA
 
. : . : . : . : . : . :
rJMSF013B04+ GATCTTCATGATACTGGTGTCCGAACGTTATGCATTTGTGAGTCACAGCAGATCAATCTT
rJMSF017C11+ GATCTTCATGATACTGGTGTCCGAACGTTATGCATTTGTGAGTCACAGCAGATCAATCTT
                      ____________________________________________________________
consensus GATCTTCATGATACTGGTGTCCGAACGTTATGCATTTGTGAGTCACAGCAGATCAATCTT
 
. : . : . : . : . : . :
rJMSF013B04+ GACAAGATTCGTGTGTGGCTCGAGGAACTCCTTTGGGACAAAAAGTATGGCATGGACATA
rJMSF017C11+ GACAAGATTCGTGTGTGGCTCGAGGAACTCCTTTGGGACAAAAAGTATGTCATGGACATA
                      ____________________________________________________________
consensus GACAAGATTCGTGTGTGGCTCGAGGAACTCCTTTGGGACAAAAAGTATGTCATGGACATA
 
. : . : . : . : . : . :
rJMSF013B04+ TATCGCTGCAAGGGAATTTTAAGAGTCATGAATTCAGATCAGCTCTATACTCTGCAGGGT
rJMSF017C11+ TATCGCTGCAAGGGAATTTTAAGAGTCATGAATTCAGATCAGCTCTATACTCTGCAGGGT
                      ____________________________________________________________
consensus TATCGCTGCAAGGGAATTTTAAGAGTCATGAATTCAGATCAGCTCTATACTCTGCAGGGT
 
. : . : . : . : . : . :
rJMSF013B04+ GTGAGAGAGATCTACGAGATTGTTTCAACTCGGGACTGGAGAAAGGAAGAAAACCAAATG
rJMSF017C11+ GTGAGAGAGATCTACGAGATTGTTTCAACTCGGGACTGGAGAAAGGAAGAAAACCAAATG
                      ____________________________________________________________
consensus GTGAGAGAGATCTACGAGATTGTTTCAACTCGGGACTGGAGAAAGGAAGAAAACCAAATG
 
. : . : . : . : . : . :
rJMSF013B04+ AACAAAATAGTTTTCATAGGTAAATCGTTAAATGAAGACATTTTGTTGGATTCTCTAAGA
rJMSF017C11+ AACAAAATAGTTTTCATAGGTAAATCGTTAAATGAAGACATTTTGTTGGATTCTCTAAGA
                      ____________________________________________________________
consensus AACAAAATAGTTTTCATAGGTAAATCGTTAAATGAAGACATTTTGTTGGATTCTCTAAGA
 
. : . : . : . : . : . :
rJMSF013B04+ GCTTGTGTAGTGGAAACCTCAACCTGAGCACATAGATGAGCTTCATGGAATTTAATACTT
rJMSF017C11+ GCTTGTGTAGTGGAAACCTCAACCTGAGCACATAGATGAGCTTCATGGAATTTAATACTT
                      ____________________________________________________________
consensus GCTTGTGTAGTGGAAACCTCAACCTGAGCACATAGATGAGCTTCATGGAATTTAATACTT
 
. : . : . : . : . : . :
rJMSF013B04+ GGTAAACTGCCTTTATTTTTGGTTAGTTCAGTATACACCATAACTATCTAAGGTTCAATT
rJMSF017C11+ GGTAAACTGCCTTTATTTTTGGTTAGTTCAGTATACACCATAACTATCTAAGGTTCAATT
                      ____________________________________________________________
consensus GGTAAACTGCCTTTATTTTTGGTTAGTTCAGTATACACCATAACTATCTAAGGTTCAATT
 
. : . : . : . : . : . :
rJMSF013B04+ TCATGATGTGCATGATGTAGAGTGTAGACAACAATTATACTATGCTCATCTCAACACTAC
rJMSF017C11+ TCATGATGTGCATGATGTAGAGTGTAGACAACAATTATACTATGCTCATCTCAACACTAC
                      ____________________________________________________________
consensus TCATGATGTGCATGATGTAGAGTGTAGACAACAATTATACTATGCTCATCTCAACACTAC
 
. : . : . : . : . : . :
rJMSF013B04+ TTGTATACA-TTTGATGCCAGAC
rJMSF017C11+ TTGTATACATTTTGATGCCAGACTTTTGTGTGTAATTTGTAAGGTGGCTATATCCTCTCC
                      ____________________________________________________________
consensus TTGTATACATTTTGATGCCAGACTTTTGTGTGTAATTTGTAAGGTGGCTATATCCTCTCC