Previous Contig 011939:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF017C06Sequence360006594 (3)690011939 (2)gb:AP003996_18361162e-68Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ11
JMSF029I06Sequence670006594 (3)gb:BT014898_16418887e-12Arabidopsis thaliana At5g28910 mRNA, complete cds.729011939 (2)gb:AP003996_18361167e-77Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ11

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF029I06+ AAGGCATTCAGCGTTCGGACAGGAAGCAGCAAA
                      ____________________________________________________________
consensus AAGGCATTCAGCGTTCGGACAGGAAGCAGCAAA
 
. : . : . : . : . : . :
rJMSF029I06+ AATGGTTCTTGAAACGCCAATCAACGATTCTCCAGAGGCGAAACATGACATAGAAAAATT
rJMSF017C06+ TCCAGAGGCGNAACATGACATAGAAAAATT
                      ____________________________________________________________
consensus AATGGTTCTTGAAACGCCAATCAACGATTCTCCAGAGGCGAAACATGACATAGAAAAATT
 
. : . : . : . : . : . :
rJMSF029I06+ CGTATGGTCAAGTCATAAACCATGGATCCCGAGGCCATTGCTCATCATGCACGTTAGAAT
rJMSF017C06+ CGTATGGTCAAGTCATAAACCATGGATCCCGAGGCCATTGCTCATCATGCACGTTAGAAT
                      ____________________________________________________________
consensus CGTATGGTCAAGTCATAAACCATGGATCCCGAGGCCATTGCTCATCATGCACGTTAGAAT
 
. : . : . : . : . : . :
rJMSF029I06+ GGGAGACAAGGCGTGTGAAATGAAGGTGGTTGGGTTTGAAGAGTACACGCAACTTGCAGA
rJMSF017C06+ GGGAGACANGGCGTGTGAAATGAAGGTGGTTGGGTTTGAAGAGTACATGCAACTTGCAGA
                      ____________________________________________________________
consensus GGGAGACAAGGCGTGTGAAATGAAGGTGGTTGGGTTTGAAGAGTACATGCAACTTGCAGA
 
. : . : . : . : . : . :
rJMSF029I06+ GCGTATAAGAAAAACCTTCCCCGAGCTGAAAAGCATCTGGCTTTCTACTGAAATGCAGGA
rJMSF017C06+ GCGTATAAGAAAAACCTTCCCCGAGCTGAAAAGCATCTGGCTTTCTACTGAAATGCAGGA
                      ____________________________________________________________
consensus GCGTATAAGAAAAACCTTCCCCGAGCTGAAAAGCATCTGGCTTTCTACTGAAATGCAGGA
 
. : . : . : . : . : . :
rJMSF029I06+ GGTCATTGATAAAACGCGGATGTATCCCCACTGGAAGTTTTACTACACAAACGTCACCCG
rJMSF017C06+ GGTCANTGATAAAACGCGGATGTATCCCCACTGGAAGTTTTANTACACAAACGTCACCCG
                      ____________________________________________________________
consensus GGTCATTGATAAAACGCGGATGTATCCCCACTGGAAGTTTTACTACACAAACGTCACCCG
 
. : . : . : . : . : . :
rJMSF029I06+ ACAAGTGGGAAACATCACAATGGCAACTTATGAAGCCAGTCTCGGCAGGGAAGTTAGCAC
rJMSF017C06+ ACAAGTGGGAAACATCACAATGGCAACTTANGAAGCCAGTCTCGGCAGGGAAGTTAGCAC
                      ____________________________________________________________
consensus ACAAGTGGGAAACATCACAATGGCAACTTATGAAGCCAGTCTCGGCAGGGAAGTTAGCAC
 
. : . : . : . : . : . :
rJMSF029I06+ GAACTATCCTCTTGTCAATTTCTTGATGGCCACCGAAGCTGATTTCTTCACCGGGGCGCT
rJMSF017C06+ GAACTATCCTCTTGTCAATTTCTTGATGGCCACCGAAGCTGATTTCTTCACCGGGGCGCT
                      ____________________________________________________________
consensus GAACTATCCTCTTGTCAATTTCTTGATGGCCACCGAAGCTGATTTCTTCACCGGGGCGCT
 
. : . : . : . : . : . :
rJMSF029I06+ GGGATCAACTTGGAGCTATCTCATCGATGGCATGAGGAACACCGGGGGAAAAGTCATGTC
rJMSF017C06+ GGGATCAACTTGGAGCTATCTCATCGATGGCATGAGGAACACCGGGGGAAAAGTCATGTC
                      ____________________________________________________________
consensus GGGATCAACTTGGAGCTATCTCATCGATGGCATGAGGAACACCGGGGGAAAAGTCATGTC
 
. : . : . : . : . : . :
rJMSF029I06+ TGGATACTTAAGCGTTAACAAAGACCGTTTTTGGTAGCGCCATGAAAGATAACTCTCAAG
rJMSF017C06+ TGGATACTTAAGCGTTAACAAAGACCGGTTTTGGTAGCGCCATGAAAGATAACTCTCAAG
                      ____________________________________________________________
consensus TGGATACTTAAGCGTTAACAAAGACCGTTTTTGGTAGCGCCATGAAAGATAACTCTCAAG
 
. : . : . : . : . : . :
rJMSF029I06+ TTTTCAGCACAGCACATTTTGTTGGAGCAGTTGCTTGCTGGTTATCTATCATCTATGCAT
rJMSF017C06+ TTTTCAGCACAGCACATTTTGTTGGAGCAGTTGCTTNCTGGTTATCTATCATCTATGCAT
                      ____________________________________________________________
consensus TTTTCAGCACAGCACATTTTGTTGGAGCAGTTGCTTGCTGGTTATCTATCATCTATGCAT
 
. : . : . : . : . : . :
rJMSF029I06+ TAGCCAAAATGAGATAAGAGGCAACAGAAAGGTACATATTGTAAAGTATTAACAATGATA
rJMSF017C06+ TAGCCAAAATGAGATAAGAGGCAACAGAAAGGTACATATTGTAAAGTATTAACAATGNTA
                      ____________________________________________________________
consensus TAGCCAAAATGAGATAAGAGGCAACAGAAAGGTACATATTGTAAAGTATTAACAATGATA
 
. : . : . : . : . : . :
rJMSF029I06+ TTTTTACCTGTAAAAAGTTTCTTACATATGTAGTTA
rJMSF017C06+ TTTTTACCTGTAAAAAGTTTCTTACATATGTAGTTATGTATCAATGTATCATCATGTTAA
                      ____________________________________________________________
consensus TTTTTACCTGTAAAAAGTTTCTTACATATGTAGTTATGTATCAATGTATCATCATGTTAA