Previous Contig 011937:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS072F10Sequence492011937 (2)gb:AY091073_15743001e-21Arabidopsis thaliana unknown protein (At5g08450) mRNA, complete cds.>gb:AY122935
JMSF017B18Sequence144005662 (2)793011937 (2)gb:AY091073_15743005e-66Arabidopsis thaliana unknown protein (At5g08450) mRNA, complete cds.>gb:AY122935

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF017B18- TATATTACTCTAC
                      ____________________________________________________________
consensus TATATTACTCTAC
 
. : . : . : . : . : . :
JMFS072F10+ AGTATCCGAAGAAATGTCCATAAATCCAAAGCAGATTGATTGTACATGAAATG
rJMSF017B18- ATAAATTAGTATCCGAAGAANTGTCCATAAATCCAAAGCAGATTGATTGTACATGAAATG
                      ____________________________________________________________
consensus ATAAATTAGTATCCGAAGAAATGTCCATAAATCCAAAGCAGATTGATTGTACATGAAATG
 
. : . : . : . : . : . :
JMFS072F10+ TCTTGAAAAACTAAGACAGATTCTGAAATAGCATTCTTTCAACACAAGATGGATGCTTTT
rJMSF017B18- TCTTGAAAAACTAAGACAGATTCTGAANTAGCATTCTTTCAACACAAGATGGATGCTTTT
                      ____________________________________________________________
consensus TCTTGAAAAACTAAGACAGATTCTGAAATAGCATTCTTTCAACACAAGATGGATGCTTTT
 
. : . : . : . : . : . :
JMFS072F10+ TATTTCACATTGGGGCTTGGACAGTAAACTAGTTCATTCAAAAACCTCTCTGCTCTGCTC
rJMSF017B18- TATTTCACATTGGGGCTTGGACAGNAAACTAGTTCATTCAAAAACCTCTCTGCTCTGCTC
                      ____________________________________________________________
consensus TATTTCACATTGGGGCTTGGACAGTAAACTAGTTCATTCAAAAACCTCTCTGCTCTGCTC
 
. : . : . : . : . : . :
JMFS072F10+ TGCTCTGCACTTGAGAGCTTAACTAATTTGGAGACAGAAAATGAGCCCTAGCAAGAACAT
rJMSF017B18- TGCTCTGCACTTGAGAGCTTAACTAATTTGGAGACAGAAAATGAGCCCTAGCAAGAACAT
                      ____________________________________________________________
consensus TGCTCTGCACTTGAGAGCTTAACTAATTTGGAGACAGAAAATGAGCCCTAGCAAGAACAT
 
. : . : . : . : . : . :
JMFS072F10+ ATTCTTTCCCTGCAATCCAAACACCAGTTTGTGACCACTGAACGTCCTCCCACTCCAGAT
rJMSF017B18- ATTCTTTCCCTGCAATCCAAACACCAGTTTGTGACCACTGAACGTCCTCCCACTCCAGAT
                      ____________________________________________________________
consensus ATTCTTTCCCTGCAATCCAAACACCAGTTTGTGACCACTGAACGTCCTCCCACTCCAGAT
 
. : . : . : . : . : . :
JMFS072F10+ TCTCCTCCAAAACCTCGACATGTTCAAGGGGCAACGGGATTCCATATGATTTCATCATTT
rJMSF017B18- TCTCCTCCAAAACCTCGACATGTTCAAGGGGCAACGGGATTCCATATGATTTCATCATTT
                      ____________________________________________________________
consensus TCTCCTCCAAAACCTCGACATGTTCAAGGGGCAACGGGATTCCATATGATTTCATCATTT
 
. : . : . : . : . : . :
JMFS072F10+ TCTGGGGCAGAGGCTTCTTGCAGCGTGACCAACGGAACACATCTACGACAACATTTTCAC
rJMSF017B18- TCTGGGGCAGAGGCTTCTTGCAGCGTGACCAACGGAACACATCTACGACAACATTTTCAC
                      ____________________________________________________________
consensus TCTGGGGCAGAGGCTTCTTGCAGCGTGACCAACGGAACACATCTACGACAACATTTTCAC
 
. : . : . : . : . : . :
JMFS072F10+ CATCCACATTTTTTTCACCGTTTACAGAATGGGAGTGATGCGCATGATGCTTCTCATTCT
rJMSF017B18- CATCCACATTTTTTTCACCGTTTACAGAATGGGAGTGATGCGCATGATGCTTCTCATTCT
                      ____________________________________________________________
consensus CATCCACATTTTTTTCACCGTTTACAGAATGGGAGTGATGCGCATGATGCTTCTCATTCT
 
. : . : . : . : . : . :
JMFS072F10+ CCACTTCATGTGCATGGGG
rJMSF017B18- CCACTTCATGTGCATGGGGCACTGCTGTAGCCTTGACCATCTTTTCTCCATTGAAGGAGA
                      ____________________________________________________________
consensus CCACTTCATGTGCATGGGGCACTGCTGTAGCCTTGACCATCTTTTCTCCATTGAAGGAGA
 
. : . : . : . : . : . :
rJMSF017B18- GCTCATACCTGCGAGTATGGGTTTCCAAATATAAGACTTCTCCCTTTTTCAGGCGTGAGG
                      ____________________________________________________________
consensus GCTCATACCTGCGAGTATGGGTTTCCAAATATAAGACTTCTCCCTTTTTCAGGCGTGAGG
 
. : . : . : . : . : . :
rJMSF017B18- ATGTGAAAAGGGGTTTCTTCAGCCCTTTGTCAGCAACAACACTTATACTGTACTTAAGCC
                      ____________________________________________________________
consensus ATGTGAAAAGGGGTTTCTTCAGCCCTTTGTCAGCAACAACACTTATACTGTACTTAAGCC
 
. : . : . : . : . : . :
rJMSF017B18- AAGGCTCATTGCATAGATTGTATTGTATTGTAACTTCACGCACAAATTTCTGTTGCCGTA
                      ____________________________________________________________
consensus AAGGCTCATTGCATAGATTGTATTGTATTGTAACTTCACGCACAAATTTCTGTTGCCGTA
 
. : . : . : . : . : . :
rJMSF017B18- ATGCATTCGATGCTGCAGCCCGTGTAGTCATTGTACGCTCCACAGCAACTGGAGCAAGAG
                      ____________________________________________________________
consensus ATGCATTCGATGCTGCAGCCCGTGTAGTCATTGTACGCTCCACAGCAACTGGAGCAAGAG