Previous Contig 011935:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF017B11Sequence510005660 (2)gb:AY048238_15617002e-48Arabidopsis thaliana At1g50380/F14I3_27 mRNA, complete cds.>gb:AY094011_1575517 798011935 (2)gb:AP005750_18571473e-77Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, BAC clone:OSJN
JMSF051C13Sequence661005660 (2)gb:AY048238_15617002e-77Arabidopsis thaliana At1g50380/F14I3_27 mRNA, complete cds.>gb:AY094011_1575517 768011935 (2)gb:AP005750_18571472e-94Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, BAC clone:OSJN

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF051C13+ GGGAGACAATGGTACGAAAATGGGAAACTGCTGAAGAAGAAAAATACTT
rJMSF017B11+ AGAAAAATACTT
                      ____________________________________________________________
consensus GGGAGACAATGGTACGAAAATGGGAAACTGCTGAAGAAGAAAAATACTT
 
. : . : . : . : . : . :
rJMSF051C13+ TCACAGATTTTATTGCTTGTGCAGAGCACTTGATTGAAAAGAAATATTGCAACAAAGAAA
rJMSF017B11+ TCACAGATTTTATTGCTTGTGCAGAGCACTTGATTGAAAAGAAATANTGCAACAAAGNAA
                      ____________________________________________________________
consensus TCACAGATTTTATTGCTTGTGCAGAGCACTTGATTGAAAAGAAATATTGCAACAAAGAAA
 
. : . : . : . : . : . :
rJMSF051C13+ AGCTTTGCATCAATGGTAGAAGTGCTGGAGGATTGCTAATTGGTGCTGTGCTCACTATGC
rJMSF017B11+ AGCTTTGCATCAATGGTAGAAGTGCTGGAGGATTGCTAATTGGTGCTGTGCTCACTATGC
                      ____________________________________________________________
consensus AGCTTTGCATCAATGGTAGAAGTGCTGGAGGATTGCTAATTGGTGCTGTGCTCACTATGC
 
. : . : . : . : . : . :
rJMSF051C13+ GTCCTGATTTATTTAAGGCAGCTGTAGCTGAAGTGCCTTTTGTAGATGTTTTAACTACAA
rJMSF017B11+ GTCCTGATTTATTTAAGGCAGCTGTAGCTGAAGTGCCTTTTGTAGATGTTTTAACTACAA
                      ____________________________________________________________
consensus GTCCTGATTTATTTAAGGCAGCTGTAGCTGAAGTGCCTTTTGTAGATGTTTTAACTACAA
 
. : . : . : . : . : . :
rJMSF051C13+ TGCTTGACCCAACTATTCCTCTAACAACTTCTGAGTGGGAGGAATGGGGTGATCCTCGTA
rJMSF017B11+ TGCTTGACCCAACTATTCCTCTAACAACTTCTGAGTGGGAGGAATGGGGTGATCCTCGTA
                      ____________________________________________________________
consensus TGCTTGACCCAACTATTCCTCTAACAACTTCTGAGTGGGAGGAATGGGGTGATCCTCGTA
 
. : . : . : . : . : . :
rJMSF051C13+ AAGAAGAATATTATTTCTACATGAAGTCATATTCTCCTGTTGATAATGTCAAGCCACAAT
rJMSF017B11+ AAGAAGAATATTATTTCTACATGAAGTCATATTCTCCTGTTGATAATGTCAAGCCACAAT
                      ____________________________________________________________
consensus AAGAAGAATATTATTTCTACATGAAGTCATATTCTCCTGTTGATAATGTCAAGCCACAAT
 
. : . : . : . : . : . :
rJMSF051C13+ GTTACCCGGATATTCTTCTTATAACTGGTTTAAATGATCCACGCGTTCTCTACTCGGAAC
rJMSF017B11+ GTTACCCGGATATTCTTCTTATAACTGGTTTAAATGATCCACGCGTTCTCTACTCGGAAC
                      ____________________________________________________________
consensus GTTACCCGGATATTCTTCTTATAACTGGTTTAAATGATCCACGCGTTCTCTACTCGGAAC
 
. : . : . : . : . : . :
rJMSF051C13+ CAGCAAAATTTGTAGCTAAGTTGAGAGATATGAAGACTGATGACAATATGCTATTGTTCA
rJMSF017B11+ CAGCAAAATTTGTAGCTAAGTTGAGAGATATGAAGACTGATGACAATATGCTATTGTTCA
                      ____________________________________________________________
consensus CAGCAAAATTTGTAGCTAAGTTGAGAGATATGAAGACTGATGACAATATGCTATTGTTCA
 
. : . : . : . : . : . :
rJMSF051C13+ AATGTGAATGCAGTGCTGGGCACTTTTCAAAATCAGGAAGGTTTGAAAAGCTCAGGGAAG
rJMSF017B11+ AATGTGAATGCAGTGCTGGGCACTTTTCAAAATCAGGAAGGTTTGAAAAGCTCAGGGAAG
                      ____________________________________________________________
consensus AATGTGAATGCAGTGCTGGGCACTTTTCAAAATCAGGAAGGTTTGAAAAGCTCAGGGAAG
 
. : . : . : . : . : . :
rJMSF051C13+ TTGCCTTCACGTATGCTTTCATGATGAAGGCCTTAAACATGATTCCTTCACCAGACTCCA
rJMSF017B11+ TTGCCTTCACGTATGCTTTCATGATGAAGGCCTTAAACATGATTCCTTCACCAGACTCCA
                      ____________________________________________________________
consensus TTGCCTTCACGTATGCTTTCATGATGAAGGCCTTAAACATGATTCCTTCACCAGACTCCA
 
. : . : . : . : . : . :
rJMSF051C13+ AGACCAACTGATAGAGTTGGATTCATCATTATGGCACTCTCTAGTTTTATTTGTTTTTTG
rJMSF017B11+ AGACCAACTGATAGAGTTGGATTCATCATTATGGCACTCTCTAGTTTTATTTGTTTTTTG
                      ____________________________________________________________
consensus AGACCAACTGATAGAGTTGGATTCATCATTATGGCACTCTCTAGTTTTATTTGTTTTTTG
 
. : . : . : . : . : . :
rJMSF051C13+ ATGATGTGTCTTTTGTATGGAACACCTTCTCATTCAACTGTTAAAATATGCCCAGTGGTA
rJMSF017B11+ ATGATGTGTCTTTTGTATGGAACACCTTCTCATTCAACTGTTAAAATATGCCCAGTGGTA
                      ____________________________________________________________
consensus ATGATGTGTCTTTTGTATGGAACACCTTCTCATTCAACTGTTAAAATATGCCCAGTGGTA
 
. : . : . : . : . : . :
rJMSF051C13+ ACATAGTTAGCTTATCAGCCAATTTTGGCTTATTTAACCACTATTAGTTGTT
rJMSF017B11+ ACATAGTTAGCTTATCAGCCAATTTTGGCTTATTTAACCACTATTAGTTGTTTGACTTAA
                      ____________________________________________________________
consensus ACATAGTTAGCTTATCAGCCAATTTTGGCTTATTTAACCACTATTAGTTGTTTGACTTAA
 
. : . : . : . : . : . :
rJMSF017B11+ ACATTCGATATAAGTTTTTGATTAATTAACTTTTTGTAATAGTTTATTTCTCTAAACTGC
                      ____________________________________________________________
consensus ACATTCGATATAAGTTTTTGATTAATTAACTTTTTGTAATAGTTTATTTCTCTAAACTGC