Previous Contig 011933:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF005K22Sequence490011933 (6)gb:AY052697_15628578e-37Arabidopsis thaliana AT5g24930/F6A4_140 mRNA, complete cds.>gb:AY143826_1583283 680011933 (6)gb:AY088432_15734511e-28Arabidopsis thaliana clone 6639 mRNA, complete sequence.
JMSF017A12Sequence483011933 (6)gb:AY052697_15628573e-36Arabidopsis thaliana AT5g24930/F6A4_140 mRNA, complete cds.>gb:AY143826_1583283 729011933 (6)gb:AY088432_15734518e-31Arabidopsis thaliana clone 6639 mRNA, complete sequence.
JMSF042E11Sequence820011933 (6)gb:AY088432_15734511e-42Arabidopsis thaliana clone 6639 mRNA, complete sequence.726011933 (6)gb:AY088432_15734512e-28Arabidopsis thaliana clone 6639 mRNA, complete sequence.

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF017A12- TCTTGCCACTACTATACTCCTAAGCCATTTGTTTATTTC
JMFF005K22- ATTTCCATCTTGCCACTACTATACTCCTAAGCCATTTGTTTATTTC
JMSF042E11- TCTTGCCACTACTATACTCCTAAGCCATTTGTTTATTTC
                      ____________________________________________________________
consensus ATTTCCATCTTGCCACTACTATACTCCTAAGCCATTTGTTTATTTC
 
. : . : . : . : . : . :
JMSF017A12- TATTCCTAGAGATTTCTTCTTTTAGATACTTGAGTCAATCAACCAAATATGGTTATTGCT
JMFF005K22- TATTCCTAGAGATTTCTTCTTTTAGATACTTGAGTCAATCAACCAAATATGGTTATTGCT
JMSF042E11- TATTCCTAGAGATTTCTTCTTTTAGATACTTGAGTCAATCAACCAAATATGGTTATTGCT
                      ____________________________________________________________
consensus TATTCCTAGAGATTTCTTCTTTTAGATACTTGAGTCAATCAACCAAATATGGTTATTGCT
 
. : . : . : . : . : . :
JMSF017A12- AATTGCGGCGGTGGCGGTGATTCTGTTATTCATTCACGAGGTTTGCCTGGTAGTTGTGGT
JMFF005K22- AATTGCGGCGGTGGCGGTGATTCTGTTATTCATTCACGAGGTTTGCCTGGTAGTTGTGGT
JMSF042E11- AATTGCGGCGGTGGCGGTGATTCTGTTATTCATTCACGAGGTTTGCCTGGTAGTTGTGGT
                      ____________________________________________________________
consensus AATTGCGGCGGTGGCGGTGATTCTGTTATTCATTCACGAGGTTTGCCTGGTAGTTGTGGT
 
. : . : . : . : . : . :
JMSF017A12- GGTAGTGATTCTGTTATTAACTCACGATGTTTGTCTGGCGGGTGGGGTGCGGCCGCCGCG
JMFF005K22- GGTAGTGATTCTGTTATTAACTCACGATGTTTGTCTGGCGGGTGGGGTGCGGCCGCCGCG
JMSF042E11- GGTAGTGATTCTGTTATTAACTCACGATGTTTGTCTGGCGGGTGGGGTGCGGCCGCCGCG
                      ____________________________________________________________
consensus GGTAGTGATTCTGTTATTAACTCACGATGTTTGTCTGGCGGGTGGGGTGCGGCCGCCGCG
 
. : . : . : . : . : . :
JMSF017A12- GCGAAACCGTGCGACTATTGCAAGGTAGCTGTGGCGTTGGTGTTTTGTCGCGTGGACGCG
JMFF005K22- GCGAAACCGTGCGACTATTGCAAGGTAGCTGTGGCGTTGGTGTTTTGTCGCGTGGACGCG
JMSF042E11- GCGAAACCGTGCGACTATTGCAAGGTAGCTGTGGCGTTGGTGTTTTGTCGCGTGGACGCG
                      ____________________________________________________________
consensus GCGAAACCGTGCGACTATTGCAAGGTAGCTGTGGCGTTGGTGTTTTGTCGCGTGGACGCG
 
. : . : . : . : . : . :
JMSF017A12- ATTTTTATGTGCCTTGAGTGTGACGCCAAGGTCCATGCTACTAACAAATTAGGGTCGAAG
JMFF005K22- ATTTTTATGTGCCTTGAGTGTGACGCCAAGGTCCATGCTACTAACAAATTAGGGTCGAAG
JMSF042E11- ATTTTTATGTGCCTTGAGTGTGACGCCAAGGTCCATGCTACTAACAAATTAGGGTCGAAG
                      ____________________________________________________________
consensus ATTTTTATGTGCCTTGAGTGTGACGCCAAGGTCCATGCTACTAACAAATTAGGGTCGAAG
 
. : . : . : . : . : . :
JMSF017A12- CATGCCCGTGTGTGGGTGTGTGAGGTTTGCGAGCACGCCCCGGCGGCGGTCACGTGCAAG
JMFF005K22- CATGCCCGTGTGTGGGTGTGTGAGGTTTGCGAGCACGCCCCGGCGGCGGTCACGTGCAAG
JMSF042E11- CATGCCCGTGTGTGGGTGTGTGAGGTTTGCGAGCACGCCCCGGCGGCGGTCACGTGCAAG
                      ____________________________________________________________
consensus CATGCCCGTGTGTGGGTGTGTGAGGTTTGCGAGCACGCCCCGGCGGCGGTCACGTGCAAG
 
. : . : . : . : . : . :
JMSF017A12- GCTGATGCGGCGGCGCTATGTGTCACGTGTGACCGCGACATCCACTCGGCTAACCCTTTG
JMFF005K22- GCTGATGCGGCGGCGCTATGTGTCACGTGTGACCGCGACATCCACTCGGCTAACCCTTTG
JMSF042E11- GCTGATGCGGCGGCGCTATGTGTCACGTGTGACCGCGACATCCACTCGGCTAACCCTTTG
                      ____________________________________________________________
consensus GCTGATGCGGCGGCGCTATGTGTCACGTGTGACCGCGACATCCACTCGGCTAACCCTTTG
 
. : . : . : . : . : . :
JMSF017A12- GCTCAGCGCCACGAGCGTGTCC
JMFF005K22- GCTCANCGCCACGAGCGTGTCC
JMSF042E11- GCTCAGCGCCACGAGCGTGTCCCCGTGGCCCCGTTCTATGACACGGCGGAGTCCGTGGTC
                      ____________________________________________________________
consensus GCTCAGCGCCACGAGCGTGTCCCCGTGGCCCCGTTCTATGACACGGCGGAGTCCGTGGTC
 
. : . : . : . : . : . :
JMSF042E11- AAGTCCACCGCCGCGACTCTCTTGGTTCCGATGAACGATTCCAACCCCCCGAACTTCGCC
                      ____________________________________________________________
consensus AAGTCCACCGCCGCGACTCTCTTGGTTCCGATGAACGATTCCAACCCCCCGAACTTCGCC
 
. : . : . : . : . : . :
JMSF042E11- CATGACAATTTCGCCTCTGATCCCTGGACTTCTTCCGCTTCGATCACCTCCTCCAAGCTG
rJMFF005K22+ TCCCTGGACTTNTTCCGCTTCGATCACNTCCTCCAAGCTG
rJMSF042E11+ TG
                      ____________________________________________________________
consensus CATGACAATTTCGCCTCTGATCCCTGGACTTCTTCCGCTTCGATCACCTCCTCCAAGCTG
 
. : . : . : . : . : . :
JMSF042E11- CCGGAAAACGCCGCCGGCGGGATGAAATCTGCGGAATTCTCGCTCTTCGACTCCGACAAC
rJMFF005K22+ CCGGAAAACGCCGCCGGCGGGATGAAATCTGCGGAATTCTCGCTCTTCGACTCCGACAAC
rJMSF042E11+ CCGGAAAACGCCGCCGGCGGGATGAAATCTGCGGAATTCTCGCTCTTCGACTCCGACAAC
rJMSF017A12+ TCCGACAAC
                      ____________________________________________________________
consensus CCGGAAAACGCCGCCGGCGGGATGAAATCTGCGGAATTCTCGCTCTTCGACTCCGACAAC
 
. : . : . : . : . : . :
JMSF042E11- TTCCTCGATTTTGAGTACCCGGTTTCCTGGGAATCAAATTCTCATCAAAACCAGTACAAT
rJMFF005K22+ TTCCTCGATTTTGAGTACCCGGTTTCCTGGGAATCAAATTCTCATCAAAACCAGTACAAT
rJMSF042E11+ TTCCTCGATTTTGAGTACCCGGTTTCCTGGGAATCAAATTCTCATCAAAACCAGTACAAT
rJMSF017A12+ TTCCTCGATTTTGAGTACCCGGTTTCCTGGGAATCAAATTCTCATCAAAACCAGTACAAT
                      ____________________________________________________________
consensus TTCCTCGATTTTGAGTACCCGGTTTCCTGGGAATCAAATTCTCATCAAAACCAGTACAAT
 
. : . : . : . : . : . :
JMSF042E11- TCCGACAGGGTTGTCCCAATCCAGACCATCAAAACGTCCGCTCCAATCATACCC
rJMFF005K22+ TCCGACAGGGTTGTCCCAATCCAGACCATCAAAACGTCCGCTCCAATCATACCCCAAGAA
rJMSF042E11+ TCCGACAGGGTTGTCCCAATCCAGACCATCAAAACGTCCGCTCCAATCATACCCCAAGAA
rJMSF017A12+ TCCGACAGGGTTGTCCCAATCCAGACCATCAAAACGTCCGCTCCAATCATACCCCAAGAA
                      ____________________________________________________________
consensus TCCGACAGGGTTGTCCCAATCCAGACCATCAAAACGTCCGCTCCAATCATACCCCAAGAA
 
. : . : . : . : . : . :
rJMFF005K22+ AAACATTTCGAGATCGATTTCATAAGATCCAACCTCACTTCCTACAACTCCGGATTCACC
rJMSF042E11+ AAACATTTCGAGATCGATTTCACAAGATCCAACCTCACTTCCTACAACTCCGGATTCACC
rJMSF017A12+ AAACATTTCGAGATCGATTTCACAAGATCCAACCTCACTTCCTACAACTCCGGATTCACC
                      ____________________________________________________________
consensus AAACATTTCGAGATCGATTTCACAAGATCCAACCTCACTTCCTACAACTCCGGATTCACC
 
. : . : . : . : . : . :
rJMFF005K22+ AAACCTTCCTTAAGTGTTTCCTCATCTTTAGACGTGGGAGTGGTCCCGGACGGGAGCTCT
rJMSF042E11+ AAACCTTCCTTAAGTGTTTCCTCATCTTTAGACGTGGGAGTGGTCCCGGACGGGAGCTCT
rJMSF017A12+ AAACCTTCCTTAAGTGTTTCCTCATCTTTAGACGTGGGAGTGGTCCCGGACGGGAGCTCT
                      ____________________________________________________________
consensus AAACCTTCCTTAAGTGTTTCCTCATCTTTAGACGTGGGAGTGGTCCCGGACGGGAGCTCT
 
. : . : . : . : . : . :
rJMFF005K22+ GTGTCGGAGATATCCTACCGGAACATCGGCGGCGGGAGCGTGGATTCCAGAGGCGGCTCG
rJMSF042E11+ GTGTCGGAGATATCCTACCGGAACATCGGCGGCGGGAGCGTGGATTCCAGAGGCGGCTCG
rJMSF017A12+ GTGTCGGAGATATCCTACCGGAACATCGGCGGCGGGAGCGTGGATTCCAGAGGCGGCTCG
                      ____________________________________________________________
consensus GTGTCGGAGATATCCTACCGGAACATCGGCGGCGGGAGCGTGGATTCCAGAGGCGGCTCG
 
. : . : . : . : . : . :
rJMFF005K22+ CAATGGAACGGAATGGATCGAGAGGCCCGGGTGCTGAGATACAGGGAGAAGAGGAAGAAC
rJMSF042E11+ CAATGGAACGGAATGGATCGAGAGGCCCGGGTGCTGAGATACAGGGAGAAGAGGAAGAAC
rJMSF017A12+ CAATGGAACGGAATGGATCGAGAGGCCCGGGTGCTGAGATACAGGGAGAAGAGGAAGAAC
                      ____________________________________________________________
consensus CAATGGAACGGAATGGATCGAGAGGCCCGGGTGCTGAGATACAGGGAGAAGAGGAAGAAC
 
. : . : . : . : . : . :
rJMFF005K22+ AGAAAGTTCGAGAAGACGATACGCTACGCTTCCAGAAAGGCGTATGCGGAAACACGGCCA
rJMSF042E11+ AGAAAGTTCGAGAAGACGATACGCTACGCTTCCAGAAAGGCGTATGCGGAAACACGGCCA
rJMSF017A12+ AGAAAGTTCGAGAAGACGATACGCTACGCTTCCAGAAAGGCGTATGCGGAAACACGGCCA
                      ____________________________________________________________
consensus AGAAAGTTCGAGAAGACGATACGCTACGCTTCCAGAAAGGCGTATGCGGAAACACGGCCA
 
. : . : . : . : . : . :
rJMFF005K22+ CGAATCAAAGGCCGCTTTGCGAAGAGAACGGAGGTTGAATCAGAATCCGACATTGATACC
rJMSF042E11+ CGAATCAAAGGCCGCTTTGCGAAGAGAACGGAGGTTGAATCAGAATCCGACATTGATACC
rJMSF017A12+ CGAATCAAAGGCCGCTTTGCGAAGAGAACGGAGGTTGAATCAGAATCCGACATTGATACC
                      ____________________________________________________________
consensus CGAATCAAAGGCCGCTTTGCGAAGAGAACGGAGGTTGAATCAGAATCCGACATTGATACC
 
. : . : . : . : . : . :
rJMFF005K22+ TTGTTTTCATCGGCAGATTCTGCCGCTGATGTTGGTAGATTCAGCGTTGTTCCCTTGATA
rJMSF042E11+ TTGTTTTCATCGGCAGATTCTGCCGCTGATGTTGGTAGATTCAGCGTTGTTCCCTTGATA
rJMSF017A12+ TTGTTTTCATCGGCAGATTCTGCCGCTGATGTTGGTAGATTCAGCGTTGTTCCCTTGATA
                      ____________________________________________________________
consensus TTGTTTTCATCGGCAGATTCTGCCGCTGATGTTGGTAGATTCAGCGTTGTTCCCTTGATA
 
. : . : . : . : . : . :
rJMFF005K22+ TGGTAGGAATCAAGAAAACAATTGACATGTTTAAAAGTGT
rJMSF042E11+ TGGTAGGAATCAAGAAAACAATTGACATGTTTAAAAGTGTTTCTAGTGTACTATAGTTTT
rJMSF017A12+ TGGTAGGAATCAAGAAAACAATTGACATGTTTAAAAGTGTTTCTAGTGTACTATAGTTTT
                      ____________________________________________________________
consensus TGGTAGGAATCAAGAAAACAATTGACATGTTTAAAAGTGTTTCTAGTGTACTATAGTTTT
 
. : . : . : . : . : . :
rJMSF042E11+ TCTTTCCTCTCTTTTTTATTCAAATTATTATGCAAATTATAATTAATTAATCCTCTATTT
rJMSF017A12+ TCTTTCCTCTCTTTTTTATTCAAATTATTATGCAAATTATAATTAATTAATCCTCTATTT
                      ____________________________________________________________
consensus TCTTTCCTCTCTTTTTTATTCAAATTATTATGCAAATTATAATTAATTAATCCTCTATTT
 
. : . : . : . : . : . :
rJMSF017A12+ TAAGTTTGGAGGAGCGGTTGGAATATTCTATCACAGCTTAGCTCTAATCGCTTTCAAAAT
                      ____________________________________________________________
consensus TAAGTTTGGAGGAGCGGTTGGAATATTCTATCACAGCTTAGCTCTAATCGCTTTCAAAAT