Previous Contig 011921:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF016O02Sequence340006670 (3)gb:AY062530_15651863e-14Arabidopsis thaliana predicted protein of unknown function (At4g03200; F4C21.12)740011921 (2)gb:AY062530_15651863e-74Arabidopsis thaliana predicted protein of unknown function (At4g03200; F4C21.12)
JMSF024I01Sequence645006670 (3)gb:AY062530_15651862e-61Arabidopsis thaliana predicted protein of unknown function (At4g03200; F4C21.12)719011921 (2)gb:AY062530_15651862e-65Arabidopsis thaliana predicted protein of unknown function (At4g03200; F4C21.12)

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF024I01+ GGTTCA
rJMSF016O02+ CTCTATGAGTTTGGTGGTTCA
                      ____________________________________________________________
consensus CTCTATGAGTTTGGTGGTTCA
 
. : . : . : . : . : . :
rJMSF024I01+ ATC-TTTNGCTGAGCTGGGCACTTGAACTACAGGACATGCAGGATGAGCTCTTCCTTGAT
rJMSF016O02+ ATCTTTTGGCTGAGCTGGGCACTTGAACTACAGGACATGCAGGATGAGCTCTTCCTTGAT
                      ____________________________________________________________
consensus ATCTTTTGGCTGAGCTGGGCACTTGAACTACAGGACATGCAGGATGAGCTCTTCCTTGAT
 
. : . : . : . : . : . :
rJMSF024I01+ AAAGAGGGAGGAGGTTATTTTTAATACCCCTGGAGAAGATCCTTCTGTTCTGCTTCGTGT
rJMSF016O02+ AAAGAGGGAGGAGGTTA-TTTTAATACCCCTGGAGAAGATCCTTCTGTTCTGCTTCGTGT
                      ____________________________________________________________
consensus AAAGAGGGAGGAGGTTATTTTTAATACCCCTGGAGAAGATCCTTCTGTTCTGCTTCGTGT
 
. : . : . : . : . : . :
rJMSF024I01+ GAAAGAAGACTACGATGGAGCTGAGCCATCGGGAAATTCCATTTCGGTAATCAATCTTGT
rJMSF016O02+ GAAAGAAGACTACGATGGAGCTGAGCCATCGGGAAATTCCATTTCGGTAATCAATCTTGT
                      ____________________________________________________________
consensus GAAAGAAGACTACGATGGAGCTGAGCCATCGGGAAATTCCATTTCGGTAATCAATCTTGT
 
. : . : . : . : . : . :
rJMSF024I01+ GAGATTGGCCTCCATGGTTGCAGGTGGGAAATCTGAGCATTACAGAGACACTGCCCAGCA
rJMSF016O02+ GAGATTGGCCTCCATGGTTGCAGGTGGGAAATCTGAGCATTACAGAGACACTGCCCAGCA
                      ____________________________________________________________
consensus GAGATTGGCCTCCATGGTTGCAGGTGGGAAATCTGAGCATTACAGAGACACTGCCCAGCA
 
. : . : . : . : . : . :
rJMSF024I01+ TGTTTTGGCAGTTTTCGAGAAGAGATTGGAAGGCACAGCTCTAGCATTGCCTTTGATGTG
rJMSF016O02+ TGTTTTGGCAGTTTTCGAGAAGAGATTGGAAGGCACAGCTCTAGCATTGCCTTTGATGTG
                      ____________________________________________________________
consensus TGTTTTGGCAGTTTTCGAGAAGAGATTGGAAGGCACAGCTCTAGCATTGCCTTTGATGTG
 
. : . : . : . : . : . :
rJMSF024I01+ TTTGGCGGCTGACATGCTTGCTGCTCCTTCAAGGAAGCAGGTAGTCATTCTCGGGCCAAA
rJMSF016O02+ TTTGGCGGCTGACATGCTTGCTGCTCCTTCAAGGAAGCAGGTAGTCATTCTCGGGCCAAA
                      ____________________________________________________________
consensus TTTGGCGGCTGACATGCTTGCTGCTCCTTCAAGGAAGCAGGTAGTCATTCTCGGGCCAAA
 
. : . : . : . : . : . :
rJMSF024I01+ GGGTTGCGACGACTTTGAAGACCTGATCGCTGCTGCTCATGCCGCTTATGATCCCAACAA
rJMSF016O02+ GGGTTGCGACGACTTTGAAGACCTGATCGCTGCTGCTCATGCCGCTTATGATCCCAACAA
                      ____________________________________________________________
consensus GGGTTGCGACGACTTTGAAGACCTGATCGCTGCTGCTCATGCCGCTTATGATCCCAACAA
 
. : . : . : . : . : . :
rJMSF024I01+ GACGGTAATTCACATCGACCCTTCTGATGTAGAAGAGATGGGATTCTGGGTGGACATGAA
rJMSF016O02+ GACGGTAATTCACATCGACCCTTCTGATGTAGAAGAGATGGGATTCTGGGTGGACATGAA
                      ____________________________________________________________
consensus GACGGTAATTCACATCGACCCTTCTGATGTAGAAGAGATGGGATTCTGGGTGGACATGAA
 
. : . : . : . : . : . :
rJMSF024I01+ TGCTAATATTGCCTCAATGGCGAAAAGCAATTCCGCTGCTGACAAGAGCGTTGCACTCGT
rJMSF016O02+ TGCTAATATTGCCTCAATGGCGAAAAGCAATTCCGCTGCTGACAAGAGCGTTGCACTCGT
                      ____________________________________________________________
consensus TGCTAATATTGCCTCAATGGCGAAAAGCAATTCCGCTGCTGACAAGAGCGTTGCACTCGT
 
. : . : . : . : . : . :
rJMSF024I01+ GTGTCAAAATTTCACGTGTAGTCCTCCCATCAGCAACGCCGAGTCTCTTGTGTCTCTGCT
rJMSF016O02+ GTGTCAAAATTTCACGTGTAGTCCTCCCATCAGCAACGCCGAGTCTCTTGTGTCTCTGCT
                      ____________________________________________________________
consensus GTGTCAAAATTTCACGTGTAGTCCTCCCATCAGCAACGCCGAGTCTCTTGTGTCTCTGCT
 
. : . : . : . : . : . :
rJMSF024I01+ ATCGCGGTACTCTGCTATCGCGGTAAAGCCACCCGGGAATTTTAATAGGGAATAAATACT
rJMSF016O02+ ATCGCGGTACTCTGCTATCGCGGTAAAGCCACCCGGGAATTTTAATAGGGAATAAATACT
                      ____________________________________________________________
consensus ATCGCGGTACTCTGCTATCGCGGTAAAGCCACCCGGGAATTTTAATAGGGAATAAATACT
 
. : . : . : . : . : . :
rJMSF024I01+ AAATATAGCAGACTGAAAATATGTTGCTGATGAGGTATGATGATACTTCTATTC
rJMSF016O02+ AAATATAGCAGACTGAAAATATGTTGCTGATGAGGTATGATGATACTTCTATTCATGAGT
                      ____________________________________________________________
consensus AAATATAGCAGACTGAAAATATGTTGCTGATGAGGTATGATGATACTTCTATTCATGAGT