Previous Contig 011915:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF003D03Sequence315004486 (2)781011915 (2)gb:LES294902_16845451e-84Lycopersicon esculentum mRNA for 3-desoxy-D-manno octulosonic acid-8-phosphate s
JMSF016M11Sequence496004486 (2)gb:LES294902_16845452e-28Lycopersicon esculentum mRNA for 3-desoxy-D-manno octulosonic acid-8-phosphate s754011915 (2)gb:LES294902_16845451e-75Lycopersicon esculentum mRNA for 3-desoxy-D-manno octulosonic acid-8-phosphate s

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF003D03+ GGCAGACAGATCTCCTTGNTGCAGCTGCCA
                      ____________________________________________________________
consensus GGCAGACAGATCTCCTTGNTGCAGCTGCCA
 
. : . : . : . : . : . :
rJMSF003D03+ AGACTGGCAAAATAATCAATATCAAGAAAGGACAGTTTTGTGCGCCATCTGTCATGTTAA
rJMSF016M11+ AAAGGACAGTTTTGTGCGCCATCTGTCATGTTAA
                      ____________________________________________________________
consensus AGACTGGCAAAATAATCAATATCAAGAAAGGACAGTTTTGTGCGCCATCTGTCATGTTAA
 
. : . : . : . : . : . :
rJMSF003D03+ ATTCTGCTGAAAAGGTCAGATTGGCTGGAAATCAAAATGTCATGGTATGTGAGAGAGGCA
rJMSF016M11+ ATTCTGCTGAAAAGGTCAGATTGGCTGGAAATCAAAATGTCATGGTATGTGAGAGAGGCA
                      ____________________________________________________________
consensus ATTCTGCTGAAAAGGTCAGATTGGCTGGAAATCAAAATGTCATGGTATGTGAGAGAGGCA
 
. : . : . : . : . : . :
rJMSF003D03+ CCATGTTTGGCTATAATGACTTGATAGTTGATCCCCGCAACTTAGAGTGGATGAGGGAAG
rJMSF016M11+ CCATGTTTGGCTATAATGACTTGATAGTTGATCCCCGCAACTTAGAGTGGATGAGGGAAG
                      ____________________________________________________________
consensus CCATGTTTGGCTATAATGACTTGATAGTTGATCCCCGCAACTTAGAGTGGATGAGGGAAG
 
. : . : . : . : . : . :
rJMSF003D03+ CTAATTGTCCAGTTGTGGCTGATATAACACATTCTTTGCAACAACCTGCTGGGAAGAAGT
rJMSF016M11+ CTAATTGTCCAGTTGTGGCTGATATAACACATTCTTTGCAACAACCTGCTGGGAAGAAGT
                      ____________________________________________________________
consensus CTAATTGTCCAGTTGTGGCTGATATAACACATTCTTTGCAACAACCTGCTGGGAAGAAGT
 
. : . : . : . : . : . :
rJMSF003D03+ TGGATGGTGGAGGTGTTGCTAGTGGTGGTCTTCGTGAATTGATTCCTTGCATTGCCAGGA
rJMSF016M11+ TGGATGGTGGAGGTGTTGCTAGTGGTGGTCTTCGTGAATTGATTCCTTGCATTGCCAGGA
                      ____________________________________________________________
consensus TGGATGGTGGAGGTGTTGCTAGTGGTGGTCTTCGTGAATTGATTCCTTGCATTGCCAGGA
 
. : . : . : . : . : . :
rJMSF003D03+ CAGCAGTTGCTGTTGGAGTGGATGGACTTTTTATGGAGGTGCATAATGATCCTTTAAATG
rJMSF016M11+ CAGCAGTTGCTGTTGGAGTGGATGGACTTTTTATGGAGGTGCATAATGATCCTTTAAATG
                      ____________________________________________________________
consensus CAGCAGTTGCTGTTGGAGTGGATGGACTTTTTATGGAGGTGCATAATGATCCTTTAAATG
 
. : . : . : . : . : . :
rJMSF003D03+ CTCCAGTTGATGGTCCTACCCAGTGGCCTCTTCGCCATCTGGAAGAACTGCTAGAAGAGC
rJMSF016M11+ CTCCAGTTGATGGTCCTACCCAGTGGCCTCTTCGCCATCTGGAAGAACTGCTAGAAGAGC
                      ____________________________________________________________
consensus CTCCAGTTGATGGTCCTACCCAGTGGCCTCTTCGCCATCTGGAAGAACTGCTAGAAGAGC
 
. : . : . : . : . : . :
rJMSF003D03+ TCATTGCTATTGGTAGGGTCAGCAAAGGGAAGAAGCAATTCAAAATTGATCTCACTCCAG
rJMSF016M11+ TCATTGCTATTGGTAGGGTCAGCAAAGGGAAGAAGCAATTCAAAATTGATCTCACTCCAG
                      ____________________________________________________________
consensus TCATTGCTATTGGTAGGGTCAGCAAAGGGAAGAAGCAATTCAAAATTGATCTCACTCCAG
 
. : . : . : . : . : . :
rJMSF003D03+ TCTGCGATTAGATTTTTCCGTGATGGACGTTGATTTCAGTGTGGTTGCTGCACCAAAGCA
rJMSF016M11+ TCTGCGATTAGATTTTTCCGTGATGGACGTTGATTTCAGTGTGGTTGCTGCACCAAAGCA
                      ____________________________________________________________
consensus TCTGCGATTAGATTTTTCCGTGATGGACGTTGATTTCAGTGTGGTTGCTGCACCAAAGCA
 
. : . : . : . : . : . :
rJMSF003D03+ ATAGGCCTTCTGGCCTTGCCTCTCTTTCATCAATATAAATAATGTAGACATGAGTCTACT
rJMSF016M11+ ATAGGCCTTCTGGCCTTGCCTCTCTTTCATCAATATAAATAATGTAGACATGAGTCTACT
                      ____________________________________________________________
consensus ATAGGCCTTCTGGCCTTGCCTCTCTTTCATCAATATAAATAATGTAGACATGAGTCTACT
 
. : . : . : . : . : . :
rJMSF003D03+ ACAGAGGCAATGATCTGGTATTGACGATTATTATGAACATTCATCTCTGTGGCAACCAAC
rJMSF016M11+ ACAGAGGCAATGATCTGGTATTGACGATTATTATGAACATTCATCTCTGTGGCAACCAAC
                      ____________________________________________________________
consensus ACAGAGGCAATGATCTGGTATTGACGATTATTATGAACATTCATCTCTGTGGCAACCAAC
 
. : . : . : . : . : . :
rJMSF003D03+ ATTTGTATTTGGATTGATTAAGATTATGGATTCATGATTGTATAACTACGCCGGTCGTTT
rJMSF016M11+ ATTTGTATTTGGATTGATTAAGATTATGGATTCATGATTGTATAACTACGCCGGTCGTTT
                      ____________________________________________________________
consensus ATTTGTATTTGGATTGATTAAGATTATGGATTCATGATTGTATAACTACGCCGGTCGTTT
 
. : . : . : . : . : . :
rJMSF003D03+ TTACTTTTTCTTAGAAATTGCTCCGGAGTAT
rJMSF016M11+ TTACTTTTTCTTAGAAATTGCTCCGGAGTATTGTCGGAGGTTGCCGGAATCGCAAGTCAT
                      ____________________________________________________________
consensus TTACTTTTTCTTAGAAATTGCTCCGGAGTATTGTCGGAGGTTGCCGGAATCGCAAGTCAT