Previous Contig 011911:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF016L09Sequence591007586 (2)643011911 (2)
JMSF043P14Sequence690007586 (2)570011911 (2)

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF043P14+ TTTATAGAA
                      ____________________________________________________________
consensus TTTATAGAA
 
. : . : . : . : . : . :
rJMSF043P14+ ACAACCATTTTTTTTTGGAAAAGNTAATGATC-TATAATCATTAAAATAACTTTACATTT
rJMSF016L09+ GGAAAAGTTAATGATCNTATAATCATTAAAATAACTTTNCATTT
                      ____________________________________________________________
consensus ACAACCATTTTTTTTTGGAAAAGTTAATGATCNTATAATCATTAAAATAACTTTACATTT
 
. : . : . : . : . : . :
rJMSF043P14+ TTAACTGGGAAATCCAGATTTTCAG-TTGATTTGTATGTAAATGATTTTTTTTTTAATAT
rJMSF016L09+ TTAACTGGGAAATCCAGATTTTCAGCTTGATTTGTATGTAAATGA-TTTTTTTTTAATAT
                      ____________________________________________________________
consensus TTAACTGGGAAATCCAGATTTTCAGCTTGATTTGTATGTAAATGATTTTTTTTTTAATAT
 
. : . : . : . : . : . :
rJMSF043P14+ ATTTACTAACATTTTTATTTAAGGGTTTGGCAAATGATGAATTGGTTATGTCTGATGCCC
rJMSF016L09+ ATTTACTAACATTTTTATTTAAGGGTTTGGCAANTGATGAATTGGNTATGTCTGATGCCC
                      ____________________________________________________________
consensus ATTTACTAACATTTTTATTTAAGGGTTTGGCAAATGATGAATTGGTTATGTCTGATGCCC
 
. : . : . : . : . : . :
rJMSF043P14+ TTTTGTAGTGAAATCATTGAGTTGTCATTAAAAGGATTACATTTAGCAACTTTCCCACTT
rJMSF016L09+ TTTTGTAGTGAAATCATNGAGTTGTCATTAAAAGGATTACATTTAGCAACTTTCCCACTT
                      ____________________________________________________________
consensus TTTTGTAGTGAAATCATTGAGTTGTCATTAAAAGGATTACATTTAGCAACTTTCCCACTT
 
. : . : . : . : . : . :
rJMSF043P14+ TTGTTCTTTATATGAGGATGATGTCCTCCTTCTGCCTGCAAATGAAGACACATAAAATCA
rJMSF016L09+ TTGTTCTTTATATGAGGATGATGTCCTCCTTCTGCCTGCAAATGAAGACACATAAAATCA
                      ____________________________________________________________
consensus TTGTTCTTTATATGAGGATGATGTCCTCCTTCTGCCTGCAAATGAAGACACATAAAATCA
 
. : . : . : . : . : . :
rJMSF043P14+ GATGCTGCTTTTTGATTGAGTGGTTTAACAGAGTTTTGGATTATTTCCATTCTTAAGATG
rJMSF016L09+ GATGCTGCTTTTTGATTGAGTGGTTTAACAGAGTTTTGGATTATTTCCATTCTTAAGATG
                      ____________________________________________________________
consensus GATGCTGCTTTTTGATTGAGTGGTTTAACAGAGTTTTGGATTATTTCCATTCTTAAGATG
 
. : . : . : . : . : . :
rJMSF043P14+ CTTCAGATGTGATGCCAAAAAGTGTTGCAGTTAAATGATGACCTGGAAAGTCTGATGCCA
rJMSF016L09+ CTTCAGATGTGATGCCAAAAAGTGTTGCAGTTAAATGATGACCTGGAAAGTCTGATGCCA
                      ____________________________________________________________
consensus CTTCAGATGTGATGCCAAAAAGTGTTGCAGTTAAATGATGACCTGGAAAGTCTGATGCCA
 
. : . : . : . : . : . :
rJMSF043P14+ AATTTGCTGTTTCATTATATAAATTATTATATGTTTAGTTTAGTAATTTCATCTCAAAGT
rJMSF016L09+ AATTTGCTGTTTCATTATATAAATTATTATATGTTTAGTTTAGTAATTTCATCTCAAAGT
                      ____________________________________________________________
consensus AATTTGCTGTTTCATTATATAAATTATTATATGTTTAGTTTAGTAATTTCATCTCAAAGT
 
. : . : . : . : . : . :
rJMSF043P14+ TCTGATTGTACACATGAGTTACTTTGATA-GGCAAATGATGATATATAAAATCTGATGCC
rJMSF016L09+ TCTGATTGTACACATGAGTTACTTTGATACGGCAAATGATGANATATAAAATCTGATGCC
                      ____________________________________________________________
consensus TCTGATTGTACACATGAGTTACTTTGATACGGCAAATGATGATATATAAAATCTGATGCC
 
. : . : . : . : . : . :
rJMSF043P14+ AAAATTACTTTGAATNTCAAAAAT
rJMSF016L09+ AAAATTACTTTGAATTTCAAAAATGTAGTTGAGTCATTTGAGTCATATGATAGTAAAGGA
                      ____________________________________________________________
consensus AAAATTACTTTGAATTTCAAAAATGTAGTTGAGTCATTTGAGTCATATGATAGTAAAGGA
 
. : . : . : . : . : . :
rJMSF016L09+ CTGNTTGTACATAGCCGTTNNTTGCCAGACCNGACGATATNCTCAATCGATGCANAATAG
                      ____________________________________________________________
consensus CTGNTTGTACATAGCCGTTNNTTGCCAGACCNGACGATATNCTCAATCGATGCANAATAG