Previous Contig 011906:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF016K13Sequence244004069 (5)794011906 (2)pir|T05845|T058452e-53hypothetical protein F17L22.160 - Arabidopsis thaliana>gb:ATCHRIV55_1546007 Arab
JMSF047K24Sequence617004069 (5)pir|T05845|T058455e-05hypothetical protein F17L22.160 - Arabidopsis thaliana>gb:ATCHRIV55_1546007 Arab276011906 (2)pir|T05845|T058452e-10hypothetical protein F17L22.160 - Arabidopsis thaliana>gb:ATCHRIV55_1546007 Arab

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF016K13+ GGATGGATGGATCG
                      ____________________________________________________________
consensus GGATGGATGGATCG
 
. : . : . : . : . : . :
rJMSF016K13+ AAGTGAACGAGGTGATCGTGAGGGTGGTCACCATGGTAGCCTTCNTCNTGCAAGCCCGCC
                      ____________________________________________________________
consensus AAGTGAACGAGGTGATCGTGAGGGTGGTCACCATGGTAGCCTTCNTCNTGCAAGCCCGCC
 
. : . : . : . : . : . :
rJMSF016K13+ TCCTGCAGNTAGCATGGAGCGCGAAATGGGAAACCGGGAATGGAAAAGGGCTGTGGGTAT
                      ____________________________________________________________
consensus TCCTGCAGNTAGCATGGAGCGCGAAATGGGAAACCGGGAATGGAAAAGGGCTGTGGGTAT
 
. : . : . : . : . : . :
rJMSF016K13+ CAGAGAGGAAAACAGTGTTTGTTTCCTTCCCTCTNTACATTGCAGGTGGATTGCTCACCA
                      ____________________________________________________________
consensus CAGAGAGGAAAACAGTGTTTGTTTCCTTCCCTCTNTACATTGCAGGTGGATTGCTCACCA
 
. : . : . : . : . : . :
rJMSF016K13+ TCCTGGTGAAATGGATGTGCAACAAAAACATGGCTACAGGGACAACATTATCTTATTATT
                      ____________________________________________________________
consensus TCCTGGTGAAATGGATGTGCAACAAAAACATGGCTACAGGGACAACATTATCTTATTATT
 
. : . : . : . : . : . :
rJMSF016K13+ CTCCCTATCAGGACAACATTAATCCACAATCTTCCACCTGGGGTGGTTTAAGGTCATACG
                      ____________________________________________________________
consensus CTCCCTATCAGGACAACATTAATCCACAATCTTCCACCTGGGGTGGTTTAAGGTCATACG
 
. : . : . : . : . : . :
rJMSF016K13+ CAGGATTCATTCTGGACGGTTTTCTGTTCCCACAGGTTCTCTTCAACATCTTCCACAGCT
                      ____________________________________________________________
consensus CAGGATTCATTCTGGACGGTTTTCTGTTCCCACAGGTTCTCTTCAACATCTTCCACAGCT
 
. : . : . : . : . : . :
rJMSF016K13+ CAAGAGAGGCGGCGCTGTCGCGGTGGTTCTACATGGGGACCACCTTAGTGCGCCTGCTGC
                      ____________________________________________________________
consensus CAAGAGAGGCGGCGCTGTCGCGGTGGTTCTACATGGGGACCACCTTAGTGCGCCTGCTGC
 
. : . : . : . : . : . :
rJMSF016K13+ CACACGCGTATGATCTTTACAGGGTTCACAACTATGCTGCTGCCATGGAAGTAGAAGGGT
                      ____________________________________________________________
consensus CACACGCGTATGATCTTTACAGGGTTCACAACTATGCTGCTGCCATGGAAGTAGAAGGGT
 
. : . : . : . : . : . :
rJMSF047K24+ CCCGAGGGCGGATTTCTACTCCNCGGCTTGGGATATCATCATTC
rJMSF016K13+ CGTACTTGTACGCGAACCCGAGGGCGGATTTCTACTCCACGGCTTGGGATATCATCATTC
                      ____________________________________________________________
consensus CGTACTTGTACGCGAACCCGAGGGCGGATTTCTACTCCACGGCTTGGGATATCATCATTC
 
. : . : . : . : . : . :
rJMSF047K24+ CCTGCCTGGGAATGCTGTCGGCTGNGATCATTNGGNTGCAGCAGCGGTTCGGTGGCCGGT
rJMSF016K13+ CCTGCCTGGGAATGCTGTTGGCTGTGATCATTTGGTTGCAGCAGCGGTTCGGTGGCCGGT
                      ____________________________________________________________
consensus CCTGCCTGGGAATGCTGTTGGCTGTGATCATTTGGTTGCAGCAGCGGTTCGGTGGCCGGT
 
. : . : . : . : . : . :
rJMSF047K24+ GTCTGCNTCCCCGGAGNTTCAGAGANTCTNTGGCGTATGAGAAAGTTGNGGCTGANGATA
rJMSF016K13+ GTTTGCTTCCCCGGAGGTTCAGAGATTCTGTGGCGTATGAGAAAGTTGTGGCTGATGATA
                      ____________________________________________________________
consensus GTTTGCTTCCCCGGAGGTTCAGAGATTCTGTGGCGTATGAGAAAGTTGTGGCTGATGATA
 
. : . : . : . : . : . :
rJMSF047K24+ GCGGTGCATANTTGTNGTGGNGATTTCAAGCCTCTCATGTTTTTGGACTTTACAAAGCTC
rJMSF016K13+ GCGGTGCATAGTTGTTGTGGTGATTTCAAGCCTCTCATGTTTTTGGACTTTACAAAGCTC
                      ____________________________________________________________
consensus GCGGTGCATAGTTGTTGTGGTGATTTCAAGCCTCTCATGTTTTTGGACTTTACAAAGCTC
 
. : . : . : . : . : . :
rJMSF047K24+ ATTTCAAGATCAGAGTCATTTTTCTGGCTCTGGCTGA-CTATGTTGTTATGTG
rJMSF016K13+ ATTTCAAGATCAGAGTCATTTTTCTGGCTCTGGCTGACCTATGTTGTTATGTGTTAAACC
                      ____________________________________________________________
consensus ATTTCAAGATCAGAGTCATTTTTCTGGCTCTGGCTGACCTATGTTGTTATGTGTTAAACC