Previous Contig 011900:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF016J16Sequence516005793 (2)gb:BT012536_16416061e-26Arabidopsis thaliana At1g13820 gene, complete cds.>gb:BT014841_1641831 Arabidops794011900 (2)gb:BT012536_16416062e-65Arabidopsis thaliana At1g13820 gene, complete cds.>gb:BT014841_1641831 Arabidops
JMSF018P23Sequence278005793 (2)gb:BT004189_16372863e-07Arabidopsis thaliana clone RAFL15-48-L05 (R50129) unknown protein (At5g39220) mR722011900 (2)gb:BT012536_16416063e-78Arabidopsis thaliana At1g13820 gene, complete cds.>gb:BT014841_1641831 Arabidops

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF016J16+ TTTGGAATACATAC
                      ____________________________________________________________
consensus TTTGGAATACATAC
 
. : . : . : . : . : . :
rJMSF016J16+ ATCAAAAGGCCTATGACNTTAGTCGGACCAAGTCTNGGATCTGCCATTGCTATCGACTTT
                      ____________________________________________________________
consensus ATCAAAAGGCCTATGACNTTAGTCGGACCAAGTCTNGGATCTGCCATTGCTATCGACTTT
 
. : . : . : . : . : . :
rJMSF016J16+ TCCGTCAACTATCCAGAAGCTGTAAGTGCTCTAAATAGATATGAGTCTGCCCTAGAGCTT
                      ____________________________________________________________
consensus TCCGTCAACTATCCAGAAGCTGTAAGTGCTCTAAATAGATATGAGTCTGCCCTAGAGCTT
 
. : . : . : . : . : . :
rJMSF016J16+ TGTATTTTACGGATATATTTGGCAATTATATGGCTCGTCCAAATGAGGCATTGTGCCCTT
                      ____________________________________________________________
consensus TGTATTTTACGGATATATTTGGCAATTATATGGCTCGTCCAAATGAGGCATTGTGCCCTT
 
. : . : . : . : . : . :
rJMSF018P23+ GTGGATAGGCTGGTTTTGATCGATGCAAGTGTATATGCAGAAGGCACTGGGGAC
rJMSF016J16+ AATCAGGTGGATAGGCTGGTTTTGATCGATGCAAGTGTATATGCAGAAGGCACTGGGGAC
                      ____________________________________________________________
consensus AATCAGGTGGATAGGCTGGTTTTGATCGATGCAAGTGTATATGCAGAAGGCACTGGGGAC
 
. : . : . : . : . : . :
rJMSF018P23+ CTTGCAACACTACCTAAAGCAGCAGCTTATGCTGGGGTCTACTTGTTGAAAAGCATCCCG
rJMSF016J16+ CTTGCAACACTACCTAAAGCAGCAGCTTATGCTGGGGTCTACTTGTTGAAAAGCATCCCG
                      ____________________________________________________________
consensus CTTGCAACACTACCTAAAGCAGCAGCTTATGCTGGGGTCTACTTGTTGAAAAGCATCCCG
 
. : . : . : . : . : . :
rJMSF018P23+ CTTCGCTGGTATGCAACTTCACTGGCTTTCAATAGTTTACCCTTCAATATTCTCGCAGAC
rJMSF016J16+ CTTCGCTGGTATGCAACTTCACTGGCTTTCAATAGTTTACCCTTCAATATTCTCGCAGAC
                      ____________________________________________________________
consensus CTTCGCTGGTATGCAACTTCACTGGCTTTCAATAGTTTACCCTTCAATATTCTCGCAGAC
 
. : . : . : . : . : . :
rJMSF018P23+ TGGACAAATATTGGGCGGTTACATTGTTTATTACCCTGGTGGGAGGATGCAACTGTTAAT
rJMSF016J16+ TGGACAAATATTGGGCGGTTACATTGTTTATTACCCTGGTGGGAGGATGCAACTGTTAAT
                      ____________________________________________________________
consensus TGGACAAATATTGGGCGGTTACATTGTTTATTACCCTGGTGGGAGGATGCAACTGTTAAT
 
. : . : . : . : . : . :
rJMSF018P23+ TTTATGATCAGTGGAGGCTATAATGTCACTGCTCAGATAAACGATGTCAAGCAAAAATCG
rJMSF016J16+ TTTATGATCAGTGGAGGCTATAATGTCACTGCTCAGATAAACGATGTCAAGCAAAAATCG
                      ____________________________________________________________
consensus TTTATGATCAGTGGAGGCTATAATGTCACTGCTCAGATAAACGATGTCAAGCAAAAATCG
 
. : . : . : . : . : . :
rJMSF018P23+ CTTATAATATGGGGAGAGAATGATCAGATTATTGACTACAAGCTTGGAGTTCGGTTGCAC
rJMSF016J16+ CTTATAATATGGGGAGAGAATGATCAGATTATTGACTACAAGCTTGGAGTTCGGTTGCAC
                      ____________________________________________________________
consensus CTTATAATATGGGGAGAGAATGATCAGATTATTGACTACAAGCTTGGAGTTCGGTTGCAC
 
. : . : . : . : . : . :
rJMSF018P23+ TGTGAATTGCCAGATGCAATCATACGCCAAATCCCAAATTGCGGTCACATCCCACACGTC
rJMSF016J16+ TGTGAATTGCCAGATGCAATCATACGCCAAATCCCAAATTGCGGTCACATCCCACACGTC
                      ____________________________________________________________
consensus TGTGAATTGCCAGATGCAATCATACGCCAAATCCCAAATTGCGGTCACATCCCACACGTC
 
. : . : . : . : . : . :
rJMSF018P23+ GAGAAGCCTGCCGCTGTTTCTAATCTGATTCGGGAGTTTGTTAGCGCCGAGAAGCCGGCT
rJMSF016J16+ GAGAAGCCTGCCGCTGTTTCTAATCTGATTCGGGAGTTTGTTAGCGCCGAGAAGCCGGCT
                      ____________________________________________________________
consensus GAGAAGCCTGCCGCTGTTTCTAATCTGATTCGGGAGTTTGTTAGCGCCGAGAAGCCGGCT
 
. : . : . : . : . : . :
rJMSF018P23+ AACAGCCTAGCAGCTAGCAGGCAAGTATGAATCCTTTGGTTAGTTATAGTTGCCAATTGA
rJMSF016J16+ AACAGCCTAGCAGCTAGCAGGCAAGTATGAATCCTTTGGTTAGTTATAGTTGCCAATTGA
                      ____________________________________________________________
consensus AACAGCCTAGCAGCTAGCAGGCAAGTATGAATCCTTTGGTTAGTTATAGTTGCCAATTGA
 
. : . : . : . : . : . :
rJMSF018P23+ TGTTTGTTAAGGAATAAAATGTGTAGTTTTGT
rJMSF016J16+ TGTTTGTTAAGGAATAAAATGTGTAGTTTTGTTGAAAAATTTATTCTTGATACCAAATCC
                      ____________________________________________________________
consensus TGTTTGTTAAGGAATAAAATGTGTAGTTTTGTTGAAAAATTTATTCTTGATACCAAATCC