Previous Contig 011898:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF016J10Sequence574004588 (33)gb:STU307031_17230411e-36Solanum tuberosum mRNA for ferredoxin I (fed1 gene).725011898 (2)gb:AY087044_15720801e-65Arabidopsis thaliana clone 30996 mRNA, complete sequence.
JMSF018F13Sequence565004676 (2)gb:AY065250_15664012e-56Arabidopsis thaliana putative alcohol dehydrogenase (At1g64710) mRNA, complete c800011898 (2)gb:AY087044_15720804e-64Arabidopsis thaliana clone 30996 mRNA, complete sequence.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF018F13+ GGAGCTGTATGGAACACCGCC
                      ____________________________________________________________
consensus GGAGCTGTATGGAACACCGCC
 
. : . : . : . : . : . :
rJMSF018F13+ GACGTCGAGCCGGCGAAACGGTAGCCGTTTTTGCCCTGGGAGCAGTCGGTTTAGCGGTAG
rJMSF016J10+ GGTAG
                      ____________________________________________________________
consensus GACGTCGAGCCGGCGAAACGGTAGCCGTTTTTGCCCTGGGAGCAGTCGGTTTAGCGGTAG
 
. : . : . : . : . : . :
rJMSF018F13+ TAGAAGGTGCGCGAACTAGAGGTGCGTCAAGAATTATTGGAGTTGACATTAACGCTGAGA
rJMSF016J10+ TAGAAGGTGCGCGAACTAGAGGTGCGTCAAGAATTATTGGAGTTGACATTAACGCTGAGA
                      ____________________________________________________________
consensus TAGAAGGTGCGCGAACTAGAGGTGCGTCAAGAATTATTGGAGTTGACATTAACGCTGAGA
 
. : . : . : . : . : . :
rJMSF018F13+ AATGTATCAAAGGTAAAGCAATTGGAATTACGGACTTTATAAACCCTAAGGAACTTGACA
rJMSF016J10+ AATGTATCAAAGGTAAAGCAATTGGAATTACGGACTTTATAAACCCTAAGGAACTTGACA
                      ____________________________________________________________
consensus AATGTATCAAAGGTAAAGCAATTGGAATTACGGACTTTATAAACCCTAAGGAACTTGACA
 
. : . : . : . : . : . :
rJMSF018F13+ AGCCTATTCACGAGAAAATTCGGGAAATGACAGAAGGAGGGGTGCATTATAGCTTTGAGT
rJMSF016J10+ AGCNTATTCACGAGAAAATTCGGGAAATGACAGAAGGAGGGGTGCATTATAGCTTTGAGT
                      ____________________________________________________________
consensus AGCCTATTCACGAGAAAATTCGGGAAATGACAGAAGGAGGGGTGCATTATAGCTTTGAGT
 
. : . : . : . : . : . :
rJMSF018F13+ GCACGGGAAACTTGGATGTTCTCCGCGAAGCGTTTTTGTCAACCAGCGACGGTTGGGGGT
rJMSF016J10+ GCACGGGAAACTTGGATGTTCTCCGCGAAGCGTTTTTGTCAACCAGCGACGGTTGGGGGT
                      ____________________________________________________________
consensus GCACGGGAAACTTGGATGTTCTCCGCGAAGCGTTTTTGTCAACCAGCGACGGTTGGGGGT
 
. : . : . : . : . : . :
rJMSF018F13+ TGACGGTGATTCTGGGAATCCATCCGAGCCCACGGCTGCTGCCGCTGCACCCAATGGAGC
rJMSF016J10+ NGACGGTGATTCTGGGAATCCATCCGAGCCCACGGCTGCTGCCGCTGCACCCAATGGAGC
                      ____________________________________________________________
consensus TGACGGTGATTCTGGGAATCCATCCGAGCCCACGGCTGCTGCCGCTGCACCCAATGGAGC
 
. : . : . : . : . : . :
rJMSF018F13+ TGTTCGACGGGCGGCGAATGGTGGCGTCGATTTTCGGGGACTTCAAAGGGAAATCGCAGC
rJMSF016J10+ TGTTCGACGGGCGGCGAATGGTGGCGTCGATTTTCGGGGACTTCAAAGGGAAATCGCAGC
                      ____________________________________________________________
consensus TGTTCGACGGGCGGCGAATGGTGGCGTCGATTTTCGGGGACTTCAAAGGGAAATCGCAGC
 
. : . : . : . : . : . :
rJMSF018F13+ TGCCGTTGTTCGCAAAGCAGTGCATGGCAGGGGAGGTAAATCTGGACGAGTTCATAACTC
rJMSF016J10+ TGCCGTTGTTCGCAAAGCAGTGCATGGCAGGGGAGGTAAATCTGGACGAGTTCATAACTC
                      ____________________________________________________________
consensus TGCCGTTGTTCGCAAAGCAGTGCATGGCAGGGGAGGTAAATCTGGACGAGTTCATAACTC
 
. : . : . : . : . : . :
rJMSF018F13+ ACGAGATGCCCTTTAGCCGCATCAATGATGCCTTCCAGCTGCTCCTCGACGGCAAATCTT
rJMSF016J10+ ACGAGATGCCCTTTAGCCGCATCAATGATGCCTTCCAGCTGCTCCTCGACGGCAAATCTT
                      ____________________________________________________________
consensus ACGAGATGCCCTTTAGCCGCATCAATGATGCCTTCCAGCTGCTCCTCGACGGCAAATCTT
 
. : . : . : . : . : . :
rJMSF018F13+ TGAGATGCCTTCTTCACTTTTGAGGTGTATGCATTCGCAATTTCGCATTCCTCCCTCCCT
rJMSF016J10+ TGAGATGCCTTCTTCACTTTTGAGGTGTATGCATTCGCAATTTCGCATTCCTCCCTCCCT
                      ____________________________________________________________
consensus TGAGATGCCTTCTTCACTTTTGAGGTGTATGCATTCGCAATTTCGCATTCCTCCCTCCCT
 
. : . : . : . : . : . :
rJMSF018F13+ CCCGCTCCATCTTCGTATGCGCGCTCGCTGTTAATTGCTTTCTACATACTTATACTTATG
rJMSF016J10+ CCCGCTCCATCTTCGTATGCGCGCTCGCTGTTAATTGCTTTCTACATACTTATACTTATG
                      ____________________________________________________________
consensus CCCGCTCCATCTTCGTATGCGCGCTCGCTGTTAATTGCTTTCTACATACTTATACTTATG
 
. : . : . : . : . : . :
rJMSF018F13+ ATATGATCGAATTGAAGATCGATGATGATCTGTACAACTCTACTCTACTTAGCTTTAATT
rJMSF016J10+ ATATGATCGAATTGAAGATCGATGATGATCTGTACAACTCTACTCTACTTAGCTTTAATT
                      ____________________________________________________________
consensus ATATGATCGAATTGAAGATCGATGATGATCTGTACAACTCTACTCTACTTAGCTTTAATT
 
. : . : . : . : . : . :
rJMSF018F13+ TCGATAAGCTAAGGCCATATGATATGCCTATATCTATATATAGTGTGTTTGGTTGCGAT
rJMSF016J10+ TCGATAAGCTAAGGCCATATGATATGCCTATATCTATATATAGTGTGTTTGGTTGCGATT
                      ____________________________________________________________
consensus TCGATAAGCTAAGGCCATATGATATGCCTATATCTATATATAGTGTGTTTGGTTGCGATT