Previous Contig 011896:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF009D04Sequence295005065 (11)782011896 (4)pir|E96561|E965616e-96hypothetical protein F5F19.21 [imported] - Arabidopsis thaliana>gb:AE005173_8931
JMSF016I03Sequence267005065 (11)797011896 (4)pir|E96561|E965614e-94hypothetical protein F5F19.21 [imported] - Arabidopsis thaliana>gb:AE005173_8931
JMSF016N17Sequence436005648 (2)805011896 (4)pir|E96561|E96561e-104hypothetical protein F5F19.21 [imported] - Arabidopsis thaliana>gb:AE005173_8931
JMSF050L08Sequence655005065 (11)gb:AB084380_15243352e-44Zinnia elegans ZeHB-10 mRNA for homeobox leucine-zipper protein, complete cds.784011896 (4)pir|E96561|E965612e-97hypothetical protein F5F19.21 [imported] - Arabidopsis thaliana>gb:AE005173_8931

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF016N17+ TTCTAGAATGGATGCCTCGAGTCCCAACCGGACGCNTGACCTAGCATCNAC
rJMSF050L08+ TGACCTAGCATCAAC
                      ____________________________________________________________
consensus TTCTAGAATGGATGCCTCGAGTCCCAACCGGACGCNTGACCTAGCATCAAC
 
. : . : . : . : . : . :
rJMSF016N17+ GCTTGAAGTTGGAACAGGTGGAACCAGGCAAACCGGTGATCAATCGAAACAGTGCAGTAC
rJMSF050L08+ GCTTGAAG-TNGAACAGGTGGAACCAGGCAAACCGGTGATCAATCGAAACAGTGCAGTAC
rJMSF009D04+ TCGAAACAGTGCAGTAC
rJMSF016I03+ TCGAAACAGTGCAGTAC
                      ____________________________________________________________
consensus GCTTGAAGTTGGAACAGGTGGAACCAGGCAAACCGGTGATCAATCGAAACAGTGCAGTAC
 
. : . : . : . : . : . :
rJMSF016N17+ CAGCAAATCAGTTATGACAATTGCTTTCCAATTTGCATTCGAGATCCATCTTCAAGAAAG
rJMSF050L08+ CAGCAAATCAGTTATGACAATTGCTTTCCAATTTGCATTCGAGATCCATCTTCAAGAAAG
rJMSF009D04+ CAGCAAATCAGTTATGACAATTGCTTTCCAATTTGCATTCGAGATCCATCTTCAAGAAAG
rJMSF016I03+ CAGCAAATCAGTTATGACAATTGCTTTCCAATTTGCATTCGAGATCCATCTTCAAGAAAG
                      ____________________________________________________________
consensus CAGCAAATCAGTTATGACAATTGCTTTCCAATTTGCATTCGAGATCCATCTTCAAGAAAG
 
. : . : . : . : . : . :
rJMSF016N17+ CATAGCTGCTATGGCTCGGTAATATGTGCGCAGTATCATATCGTCTGTTCAAAGGGTAGC
rJMSF050L08+ CATAGCTGCTATGGCTCGGCAATATGTGCGCAGTATCATATCGTCTGTTCAAAGGGTAGC
rJMSF009D04+ CATAGCTGCTATGGCTCGGCAATATGTGCGCAGTATCATATCGTCTGTTCAAAGGGTAGC
rJMSF016I03+ CATAGCTGCTATGGCTCGGCAATATGTGCGCAGTATCATATCGTCTGTTCAAAGGGTAGC
                      ____________________________________________________________
consensus CATAGCTGCTATGGCTCGGCAATATGTGCGCAGTATCATATCGTCTGTTCAAAGGGTAGC
 
. : . : . : . : . : . :
rJMSF016N17+ ATTGGCTCTGTCTCCTTCCCAACTTAGTCCTCATGCCGGTCTGCGCCCTCCACCTGGCAC
rJMSF050L08+ ATTGGCTCTGTCTCCTTCCCAACTTAGTCCTCATGCCGGTCTGCGCCCTCCACCTGGCAC
rJMSF009D04+ ATTGGCTCTGTCTCCTTCCCAACTTAGTCCTCATGCCGGTCTGCGCCCTCCACCTGGCAC
rJMSF016I03+ ATTGGCTCTGTCTCCTTCCCAACTTAGTCCTCATGCCGGTCTGCGCCCTCCACCTGGCAC
                      ____________________________________________________________
consensus ATTGGCTCTGTCTCCTTCCCAACTTAGTCCTCATGCCGGTCTGCGCCCTCCACCTGGCAC
 
. : . : . : . : . : . :
rJMSF016N17+ ACCCGAAGCTCATACTCTTGCCCGTTGGATCTGTCAAAGCTATAGATTCTTTTTGGGCAT
rJMSF050L08+ ACCCGAAGCTCATACTCTTGCCCGTTGGATCTGTCAAAGCTATAGATTCTTTTTGGGCAT
rJMSF009D04+ ACCCGAAGCTCATACTCTTGCCCGTTGGATCTGTCAAAGCTATAGATTCTTTTTGGGCAT
rJMSF016I03+ ACCCGAAGCTCATACTCTTGCCCGTTGGATCTGTCAAAGCTATAGATTCTTTTTGGGCAT
                      ____________________________________________________________
consensus ACCCGAAGCTCATACTCTTGCCCGTTGGATCTGTCAAAGCTATAGATTCTTTTTGGGCAT
 
. : . : . : . : . : . :
rJMSF016N17+ GGATCTTCTCAAATCTGCTAGTGAAGGAGGTGAATCGATCCTCAAATCATTATGGCACCA
rJMSF050L08+ GGATCTTCTCAAATCTGCTAGTGAAGGAGGTGAATCGATCCTCAAATCATTATGGCACCA
rJMSF009D04+ GGATCTTCTCAAATCTGCTAGTGAAGGAGGTGAATCGATCCTCAAATCATTATGGCACCA
rJMSF016I03+ GGATCTTCTCAAATCTGCTAGTGAAGGAGGTGAATCGATCCTCAAATCATTATGGCACCA
                      ____________________________________________________________
consensus GGATCTTCTCAAATCTGCTAGTGAAGGAGGTGAATCGATCCTCAAATCATTATGGCACCA
 
. : . : . : . : . : . :
rJMSF016N17+ CTCAGATGCTCTTATGTGTTGCTCTTTAAAGGCATTGCCAGTTTTCTCATTCGCAAACGA
rJMSF050L08+ CTCAGATGCTCTTATGTGTTGCTCTTTAAAGGCATTGCCAGTTTTCTCATTCGCAAACGA
rJMSF009D04+ CTCAGATGCTCTTATGTGTTGCTCTTTAAAGGCATTGCCAGTTTTCTCATTCGCAAACGA
rJMSF016I03+ CTCAGATGCTCTTATGTGTTGCTCTTTAAAGGCATTGCCAGTTTTCTCATTCGCAAACGA
                      ____________________________________________________________
consensus CTCAGATGCTCTTATGTGTTGCTCTTTAAAGGCATTGCCAGTTTTCTCATTCGCAAACGA
 
. : . : . : . : . : . :
rJMSF016N17+ AGCAGGACTTGATATGCTTGAAACCACCTTAGTTGCTCTCCAAGATATTACTCTGGAAAA
rJMSF050L08+ AGCAGGACTTGATATGCTTGAAACCACCTTAGTTGCTCTCCAAGATATTACTCTGGAAAA
rJMSF009D04+ AGCAGGACTTGATATGCTTGAAACCACCTTAGTTGCTCTCCAAGATATTACTCTGGAAAA
rJMSF016I03+ AGCAGGACTTGATATGCTTGAAACCACCTTAGTTGCTCTCCAAGATATTACTCTGGAAAA
                      ____________________________________________________________
consensus AGCAGGACTTGATATGCTTGAAACCACCTTAGTTGCTCTCCAAGATATTACTCTGGAAAA
 
. : . : . : . : . : . :
rJMSF016N17+ GGTTTTTGATGACAATGGCAGAAAAACACTCTTCTCAGAGCTTCCACAGATTATGCAGCA
rJMSF050L08+ GGTTTTTGATGACAATGGCAGAAAAACACTCTTCTCAGAGCTTCCACAGATTATGCAGCA
rJMSF009D04+ GGTTTTTGATGACAATGGCAGAAAAACACTCTTCTCAGAGCTTCCACAGATTATGCAGCA
rJMSF016I03+ GGTTTTTGATGACAGTGGCAGAAAAACACTCTTCTCAGAGCTTCCACAGATTATGCAGCA
                      ____________________________________________________________
consensus GGTTTTTGATGACAATGGCAGAAAAACACTCTTCTCAGAGCTTCCACAGATTATGCAGCA
 
. : . : . : . : . : . :
rJMSF016N17+ GGGCTTCACTTGTCTTCAAGGCGGCATCTGTTTGTCAAGCATGGGGAGGCCGGTTTCATA
rJMSF050L08+ GGGCTTCACTTGTCTTCAAGGCGGCATCTGTTTGTCAAGCATGGGGAGGCCGGTTTCATA
rJMSF009D04+ GGGCTTCACTTGTCTTCAAGGCGGCATCTGTTTGTCAAGCATGGGGAGGCCGGTTTCATA
rJMSF016I03+ GGGCTTCACTTGTCTTCAAGGCGGCATCTGTTTGTCAAGCATGGGGAGGCCGGTTTCATA
                      ____________________________________________________________
consensus GGGCTTCACTTGTCTTCAAGGCGGCATCTGTTTGTCAAGCATGGGGAGGCCGGTTTCATA
 
. : . : . : . : . : . :
rJMSF016N17+ CGAGAGGGCAGTGGCATGGAAAGTGCTGAATGAAGAAGAAAACCCACACTCTATATGCTT
rJMSF050L08+ CGAGAGGGCAGTGGCATGGAAAGTGCTGAATGAAGAAGAAAACCCACACTCTATATGCTT
rJMSF009D04+ CGAGAGGGCAGTGGCATGGAAAGTGCTGAATGAAGAAGAAAACCCACACTCTATATGCTT
rJMSF016I03+ CGAGAGGGCAGTGGCATGGAAAGTGCTGAATGAAGAAGAAAACCCACACTCTATATGCTT
                      ____________________________________________________________
consensus CGAGAGGGCAGTGGCATGGAAAGTGCTGAATGAAGAAGAAAACCCACACTCTATATGCTT
 
. : . : . : . : . : . :
rJMSF016N17+ CATGTTCATCAACTGGTCTTTTGTCTGAGGTTTTATTTTAGCATTCTGCTTAGGAAGGAA
rJMSF050L08+ CATGTTCATCAACTGGTCTTTTGTCTGAGGTTTTATTTTAGCATTCTGCTTAGGAAGGAA
rJMSF009D04+ CATGTTCATCAACTGGTCTTTTGTCTGAGGTTTTATTTTAGCATTCTGCTTAGGAAGGAA
rJMSF016I03+ CATGTTCATCAACTGGTCTTTTGTCTGAGGTTTTATTTTAGCATTCTGCTTAGGAAGGAA
                      ____________________________________________________________
consensus CATGTTCATCAACTGGTCTTTTGTCTGAGGTTTTATTTTAGCATTCTGCTTAGGAAGGAA
 
. : . : . : . : . : . :
rJMSF016N17+ TCTGTATAAGAAACTACAGTAGATTAAACATCAG
rJMSF050L08+ TCTGTATAAGAAACTACAGTAGATTAAACATCAGTGTT
rJMSF009D04+ TCTGTATAAGAAACTACAGTAGATTAAACATCAGTGTTTGCTTATATACAATAGACATGC
rJMSF016I03+ TCTGTATAAGAAACTACAGTAGATTAAACATCAGTGTTTGCTTATATACAATAGACATGC
                      ____________________________________________________________
consensus TCTGTATAAGAAACTACAGTAGATTAAACATCAGTGTTTGCTTATATACAATAGACATGC
 
. : . : . : . : . : . :
rJMSF009D04+ TTAATTTTGCCTTTCTAACTATCATTTAGTGCTCTCGTC
rJMSF016I03+ TTAATTTTGCCTTTCTAACTATCATTTAGTGCTCTCGTCTGTATGTAGTTTTTCCAGGGT
                      ____________________________________________________________
consensus TTAATTTTGCCTTTCTAACTATCATTTAGTGCTCTCGTCTGTATGTAGTTTTTCCAGGGT