Previous Contig 011894:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF016H17Sequence191006312 (14)pir|T51539|T515398e-09hypothetical protein T20K14_220 - Arabidopsis thaliana>gb:ATT20K14_1555001 Arabi688011894 (3)pir|D96525|D965254e-30protein T1N15.19 [imported] - Arabidopsis thaliana>gb:AE005173_892818 Arabidopsi
JMSF040P12Sequence640011894 (3)pir|D96525|D965252e-46protein T1N15.19 [imported] - Arabidopsis thaliana>gb:AE005173_892818 Arabidopsi832011894 (3)pir|D96525|D965252e-45protein T1N15.19 [imported] - Arabidopsis thaliana>gb:AE005173_892818 Arabidopsi

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF040P12- GAGCTTCGAGATTTTTTGGTTCCTTCGGAGCATCA
                      ____________________________________________________________
consensus GAGCTTCGAGATTTTTTGGTTCCTTCGGAGCATCA
 
. : . : . : . : . : . :
JMSF040P12- ATTTTCCGGAGCCGCCACCACTCCTGGGCAGCTCCTCGGCCTCCCATCCGCTTCGCCAAC
                      ____________________________________________________________
consensus ATTTTCCGGAGCCGCCACCACTCCTGGGCAGCTCCTCGGCCTCCCATCCGCTTCGCCAAC
 
. : . : . : . : . : . :
JMSF040P12- CCCCACCGCTATTGCTCGTCCGCGGTAGCTTCCGACTTTGCTCATGCAGTTCCGGTTAGC
                      ____________________________________________________________
consensus CCCCACCGCTATTGCTCGTCCGCGGTAGCTTCCGACTTTGCTCATGCAGTTCCGGTTAGC
 
. : . : . : . : . : . :
JMSF040P12- TCTGAGAATCCCGCCAATGCTCGGAACCACCCTTGGCCGGAATGGACTAGCTTTGTTGAC
                      ____________________________________________________________
consensus TCTGAGAATCCCGCCAATGCTCGGAACCACCCTTGGCCGGAATGGACTAGCTTTGTTGAC
 
. : . : . : . : . : . :
JMSF040P12- TGTTTGAAAACCAAAGGGTACTTAACGGAAAGTAGAACTGCTTCATCTCCGGGTGATATC
                      ____________________________________________________________
consensus TGTTTGAAAACCAAAGGGTACTTAACGGAAAGTAGAACTGCTTCATCTCCGGGTGATATC
 
. : . : . : . : . : . :
JMSF040P12- GCGAGCGAAGGAAATGGGAACGAGTTAGCTTATGCGGATATGAATATACTGAAAAATGCT
rJMSF040P12+ AAATGGGAACGAGTTAGCTTATGCGGATATGAATATACTGAAAAATGCT
                      ____________________________________________________________
consensus GCGAGCGAAGGAAATGGGAACGAGTTAGCTTATGCGGATATGAATATACTGAAAAATGCT
 
. : . : . : . : . : . :
JMSF040P12- TGTCTCAACTTCAGTCGTGACCGTTTCGACATTCTAAAAATGTTGTCTACCGAAGATATG
rJMSF040P12+ TGTCTCAACTTCAGTCGTGACCGTTTCGACATTCTAAAAATGTTGTCTACCGAAGATATG
                      ____________________________________________________________
consensus TGTCTCAACTTCAGTCGTGACCGTTTCGACATTCTAAAAATGTTGTCTACCGAAGATATG
 
. : . : . : . : . : . :
JMSF040P12- CAAGCAGTTGTAGAAAAGGGATGTCCTAATCTATTTCGGAAGGCTGTTAATTCAGCAAAA
rJMSF040P12+ CAAGCAGTTGTAGAAAAGGGATGTCCTAATCTATTTCGGAAGGCTGTTAATTCAGCAAAA
                      ____________________________________________________________
consensus CAAGCAGTTGTAGAAAAGGGATGTCCTAATCTATTTCGGAAGGCTGTTAATTCAGCAAAA
 
. : . : . : . : . : . :
JMSF040P12- AGATTGAGAGTCTATCTACNGCTCGATGAAGGACATGCATGTGGTGCATGCAATTTGCGG
rJMSF040P12+ AGATTGAGAGTCTATCTACAGCTCGATGAAGGACATGCATGTGGTGCATGCAATTTGCGG
                      ____________________________________________________________
consensus AGATTGAGAGTCTATCTACAGCTCGATGAAGGACATGCATGTGGTGCATGCAATTTGCGG
 
. : . : . : . : . : . :
JMSF040P12- GGTTCATGTGATAGGGCCTATGTGTTATTAAAAGAACTTGAAGGAGATGCACGTACAGTG
rJMSF040P12+ GGTTCATGTGATAGGGCCTATGTGTTATTAAAAGAACTTGAAGGAGATGCACGTACAGTG
                      ____________________________________________________________
consensus GGTTCATGTGATAGGGCCTATGTGTTATTAAAAGAACTTGAAGGAGATGCACGTACAGTG
 
. : . : . : . : . : . :
JMSF040P12- GATATTGTACGCATCCTGTTGTTGTATGCGCTGGATCCACTGGTGATTTCAGGGGGAGAG
rJMSF040P12+ GATATTGTACGCATCCTGTTGTTGTATGCGCTGGATCCACTGGTGATTTCAGGGGGAGAG
rJMSF016H17+ GGATCCACTGGTGATTTCAGGGGGAGNG
                      ____________________________________________________________
consensus GATATTGTACGCATCCTGTTGTTGTATGCGCTGGATCCACTGGTGATTTCAGGGGGAGAG
 
. : . : . : . : . : . :
JMSF040P12- AAGCC
rJMSF040P12+ AAGCCTCCTGGTAGAGAGCTTATTGATGCATCTGTAAGAAAATTGCTGTTGGAGTTGATT
rJMSF016H17+ AAGCCTCNTGGTAGAGAGCTTATTGATGCNTCTGTAAGAAAATTGCTGTTGGAGTTGANT
                      ____________________________________________________________
consensus AAGCCTCCTGGTAGAGAGCTTATTGATGCATCTGTAAGAAAATTGCTGTTGGAGTTGATT
 
. : . : . : . : . : . :
rJMSF040P12+ GAGCTAAGCGAAACACCTATAGATCCGAAAATAACAAAACCTACTCCCAAAGCTTTTTTG
rJMSF016H17+ GAGCTAAGCGAAACACCTATAGNTCCGAAAATAACAAAACCTACTCCCAAAGCTTTTTTG
                      ____________________________________________________________
consensus GAGCTAAGCGAAACACCTATAGATCCGAAAATAACAAAACCTACTCCCAAAGCTTTTTTG
 
. : . : . : . : . : . :
rJMSF040P12+ GAAAAGAAGCGCACTTCTGATTCCATAGTAGATGAAGGCTTGGAAAGCAATGAATTGAAA
rJMSF016H17+ GAAAAGAAGCGCACTTCTGATTCCNTAGTAGATGAAGGCTTGNAAAGCAATGNATTGAAA
                      ____________________________________________________________
consensus GAAAAGAAGCGCACTTCTGATTCCATAGTAGATGAAGGCTTGGAAAGCAATGAATTGAAA
 
. : . : . : . : . : . :
rJMSF040P12+ AATGGACATTTGATGAGGCGTGAGATAAATACACATAGAAAGGTTGGCAAGGATGATGTT
rJMSF016H17+ AATGGACNTTTGATGAGGCGTGAGATAAATACACATAGAAAGGTTGGCAAGGATGATGTT
                      ____________________________________________________________
consensus AATGGACATTTGATGAGGCGTGAGATAAATACACATAGAAAGGTTGGCAAGGATGATGTT
 
. : . : . : . : . : . :
rJMSF040P12+ AAAATGAAAAAAGGAGATTGGATATGCTCTGGGT
rJMSF016H17+ AAAATGAAAAAAGGAGATNGGATATGCTCTGGGTGCAACTTTATAAACTTCTCCAGGAAT
                      ____________________________________________________________
consensus AAAATGAAAAAAGGAGATTGGATATGCTCTGGGTGCAACTTTATAAACTTCTCCAGGAAT
 
. : . : . : . : . : . :
rJMSF016H17+ ATGCAATGCTTGAAATGCAGAGCAGAGGCGCCAGAGAGAGTTNCTGAAAANGATATTGAA
                      ____________________________________________________________
consensus ATGCAATGCTTGAAATGCAGAGCAGAGGCGCCAGAGAGAGTTNCTGAAAANGATATTGAA
 
. : . : . : . : . : . :
rJMSF016H17+ ATGAAAAAAGGAGATTGGAAGTGCATAACATGCACGTTTATAAATTTTGCGAGCAGAAGT
                      ____________________________________________________________
consensus ATGAAAAAAGGAGATTGGAAGTGCATAACATGCACGTTTATAAATTTTGCGAGCAGAAGT
 
. : . : . : . : . : . :
rJMSF016H17+ AGCTGTAAAAGATGTGCAGGGCCACGCCCCAAAAGGCAGCTAAATCCCNGGGAGTGGGAG
                      ____________________________________________________________
consensus AGCTGTAAAAGATGTGCAGGGCCACGCCCCAAAAGGCAGCTAAATCCCNGGGAGTGGGAG
 
. : . : . : . : . : . :
rJMSF016H17+ TGTCCCTCATGTGACTTCTTGAACTATAGAAACAACATGGTCTGCAAGAAATGTAATCAC
                      ____________________________________________________________
consensus TGTCCCTCATGTGACTTCTTGAACTATAGAAACAACATGGTCTGCAAGAAATGTAATCAC
 
. : . : . : . : . : . :
rJMSF016H17+ GACCGCCCCAGAGATCTNCAGGCTAAGAAACAATATGAAGACCAGTTATGGAAGAAGCCT
                      ____________________________________________________________
consensus GACCGCCCCAGAGATCTNCAGGCTAAGAAACAATATGAAGACCAGTTATGGAAGAAGCCT
 
. : . : . : . : . : . :
rJMSF016H17+ TCTTAAGTAGATACATTTAAGCCAATGCTTTTTCTTGTAATTAACAGACTCTTGAAATTT
                      ____________________________________________________________
consensus TCTTAAGTAGATACATTTAAGCCAATGCTTTTTCTTGTAATTAACAGACTCTTGAAATTT