Previous Contig 011889:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF016G14Sequence543011889 (4)gb:AC073405_15410597e-44Oryza sativa (japonica cultivar-group) chromosome 5 clone P0036D10, complete seq749011889 (4)gb:AC073405_15410593e-98Oryza sativa (japonica cultivar-group) chromosome 5 clone P0036D10, complete seq
JMSF035L22Sequence642011889 (4)gb:ATAC013428_15435101e-61Arabidopsis thaliana chromosome III BAC F18K10 genomic sequence, complete sequen632011889 (4)gb:AC073405_15410598e-78Oryza sativa (japonica cultivar-group) chromosome 5 clone P0036D10, complete seq

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF016G14- GAAGGAAACCCTTCCTCGATTCAACTCT
JMSF035L22- GAAGGAAACCCTTCCTCGATTCAACTCT
                      ____________________________________________________________
consensus GAAGGAAACCCTTCCTCGATTCAACTCT
 
. : . : . : . : . : . :
JMSF016G14- TAACGTCGTCATCGCGAAAATCAGCTCTCGTTGCTTAGAAACTTCGTCCACAGCTTCCCC
JMSF035L22- TAACGTCGTCATCGCGAAAATCAGCTCTCGTTGCTTAGAAACTTCGTCCACAGCTTCCCC
                      ____________________________________________________________
consensus TAACGTCGTCATCGCGAAAATCAGCTCTCGTTGCTTAGAAACTTCGTCCACAGCTTCCCC
 
. : . : . : . : . : . :
JMSF016G14- TTTGGTTGAAGACTCAAAGTCATATCATTACATTCCCAACGCTTTCCGGTTCGACATTTT
JMSF035L22- TTTGGTTGAAGACTCAAAGTCATATCATTACATTCCCAACGCTTTCCGGTTCGACATTTT
                      ____________________________________________________________
consensus TTTGGTTGAAGACTCAAAGTCATATCATTACATTCCCAACGCTTTCCGGTTCGACATTTT
 
. : . : . : . : . : . :
JMSF016G14- CTCTCCCGTACACATATATCATCACGATTTCGATCTCCGGCTTCTAGCTTGAATTCGCGA
JMSF035L22- CTCTCCCGTACACATATATCATCACGATTTCGATCTCCGGCTTCTAGCTTGAATTCGCGA
                      ____________________________________________________________
consensus CTCTCCCGTACACATATATCATCACGATTTCGATCTCCGGCTTCTAGCTTGAATTCGCGA
 
. : . : . : . : . : . :
JMSF016G14- CCCTCAATCTCACGCTAACCCGACAAAAGTCGCAGAACAGGAAAATGAAGAGAGTCTTCG
JMSF035L22- CCCTCAATCTCACGCTAACCCGACAAAAGTCGCAGAACAGGAAAATGAAGAGAGTCTTCG
                      ____________________________________________________________
consensus CCCTCAATCTCACGCTAACCCGACAAAAGTCGCAGAACAGGAAAATGAAGAGAGTCTTCG
 
. : . : . : . : . : . :
JMSF016G14- GTGTTAAGAAAGACAAAGAGCCTCCTCCCTCTATTCAAGACGCTTCCGATCGGATTAATA
JMSF035L22- GTGTTAAGAAAGACAAAGAGCCTCCTCCCTCTATTCAAGACGCTTCCGATCGGATTAATA
rJMSF016G14+ CTATTCAAGACGCTTCCGATCGGATTAATA
                      ____________________________________________________________
consensus GTGTTAAGAAAGACAAAGAGCCTCCTCCCTCTATTCAAGACGCTTCCGATCGGATTAATA
 
. : . : . : . : . : . :
JMSF016G14- AAAGAGGTGACACCGTGGAGGATAAAATCAAGAAGCTGGATGCTGAACTTGCAAGATACA
JMSF035L22- AAAGAGGTGACACCGTGGAGGATAAAATCAAGAAGCTGGATGCTGAACTTGCAAGATACA
rJMSF016G14+ AAAGAGGTGACACCGTGGAGGATAAAATCAAGAAGCTGGATGCTGAACTTGCAAGATACA
                      ____________________________________________________________
consensus AAAGAGGTGACACCGTGGAGGATAAAATCAAGAAGCTGGATGCTGAACTTGCAAGATACA
 
. : . : . : . : . : . :
JMSF016G14- AAGAGCAGATAAAGAAGACCAGGCCTGGTCCAGCTCAAGAGGCCGTCAAAGCTCGAGCCA
JMSF035L22- AAGAGCAGATAAAGAAGACCAGGCCTGGTCCAGCTCAAGAGGCCGTCAAAGCTCGAGCCA
rJMSF035L22+ TCCAGCTCAAGAGGCCGTCAAAGCTCGAGCCA
rJMSF016G14+ AAGAGCAGATAAAGAAGACCAGGCCTGGTCCAGCTCAAGAGGCCGTCAAAGCTCGAGCCA
                      ____________________________________________________________
consensus AAGAGCAGATAAAGAAGACCAGGCCTGGTCCAGCTCAAGAGGCCGTCAAAGCTCGAGCCA
 
. : . : . : . : . : . :
JMSF016G14- TGAGGGTTCTCAAGCAAAAGAGAATGTATGAAGGTCAGCGTGATATGCTCTATAATCAGA
JMSF035L22- TGAGGGTTCTCAAGCAAAAGAGAATGTATGAAGGTCAGCGTGATATGCTCTATAATCAGA
rJMSF035L22+ TGAGGGTTCTCAAGCAAAAGAGAATGTATGAAGGTCAGCGTGATATGCTCTATAATCAGA
rJMSF016G14+ TGAGGGTTCTCAAGCAAAAGAGAATGTATGAAGGTCAGCGTGATATGCTCTATAATCAGA
                      ____________________________________________________________
consensus TGAGGGTTCTCAAGCAAAAGAGAATGTATGAAGGTCAGCGTGATATGCTCTATAATCAGA
 
. : . : . : . : . : . :
JMSF016G14- CATTCAACCTAGACCAAGTTGCATTTGCTTCTGAG
JMSF035L22- CATTCAACCTAGACCAAGTTGCATTTGCTTCTGAGGGGATCAAAGATGCTCAGCAAACAA
rJMSF035L22+ CATTCAACCTAGACCAAGTTGCATTTGCTTCTGAGGGGATCAAAGATGCTCAGCAAACAA
rJMSF016G14+ CATTCAACCTAGACCAAGTTGCATTTGCTTCTGAGGGGATCAAAGATGCTCAGCAAACAA
                      ____________________________________________________________
consensus CATTCAACCTAGACCAAGTTGCATTTGCTTCTGAGGGGATCAAAGATGCTCAGCAAACAA
 
. : . : . : . : . : . :
JMSF035L22- TGTCAGCTTTGAAATCGGCTAATAAAGAGTTGAAAGGAATGATGAAGACTGTGAAGATTC
rJMSF035L22+ TGTCAGCTTTGAAATCGGCTAATAAAGAGTTGAAAGGAATGATGAAGACTGTGAAGATTC
rJMSF016G14+ TGTCAGCTTTGAAATCGGCTAATAAAGAGTTGAAAGGAATGATGAAGACTGTGAAGATTC
                      ____________________________________________________________
consensus TGTCAGCTTTGAAATCGGCTAATAAAGAGTTGAAAGGAATGATGAAGACTGTGAAGATTC
 
. : . : . : . : . : . :
JMSF035L22- AAGACATTGATAAC
rJMSF035L22+ AAGACATTGATAACTTGCAAGATGAAATGATGGACCTTATGGATGTTAGCAATGAAATCC
rJMSF016G14+ AAGACATTGATAACTTGCAAGATGAAATGATGGACCTTATGGATGTTAGCAATGAAATCC
                      ____________________________________________________________
consensus AAGACATTGATAACTTGCAAGATGAAATGATGGACCTTATGGATGTTAGCAATGAAATCC
 
. : . : . : . : . : . :
rJMSF035L22+ AAGAAACCCTTGGTAGAAGCTACAGTGTTCCAGAGGACATTGATGAAGAAGAACTCATGG
rJMSF016G14+ AAGAAACCCTTGGTAGAAGCTACAGTGTTCCAGAGGACATTGATGAAGAAGAACTCATGG
                      ____________________________________________________________
consensus AAGAAACCCTTGGTAGAAGCTACAGTGTTCCAGAGGACATTGATGAAGAAGAACTCATGG
 
. : . : . : . : . : . :
rJMSF035L22+ GTGAGCTTGATGCTTTGGAAGCGGACATGGAAAGTGAAGGTGACAGTGTCCCTTCATACC
rJMSF016G14+ GTGAGCTTGATGCTTTGGAAGCGGACATGGAAAGTGAAGGTGACAGTGTCCCTTCATACC
                      ____________________________________________________________
consensus GTGAGCTTGATGCTTTGGAAGCGGACATGGAAAGTGAAGGTGACAGTGTCCCTTCATACC
 
. : . : . : . : . : . :
rJMSF035L22+ TTCAACCAGACAAGGAGCCCGATTACTCAGAGCTTAACTTGCCAGCAGCACCAACTGGCC
rJMSF016G14+ TTCAACCAGACAAGGAGCCCGATTACTCAGAGCTTAACTTGCCAGCAGCACCAACTGGCC
                      ____________________________________________________________
consensus TTCAACCAGACAAGGAGCCCGATTACTCAGAGCTTAACTTGCCAGCAGCACCAACTGGCC
 
. : . : . : . : . : . :
rJMSF035L22+ ATGCCCCAGTAGCAAATCAGGCGGAAGACGAACTGGGCTTACCTGCTGTCCCCCGGGCCT
rJMSF016G14+ ATGCCCCAGTAGCAAATCAGGCGGAAGACGAACTGGGCTTACCTGCTGTCCCCCGGGCCT
                      ____________________________________________________________
consensus ATGCCCCAGTAGCAAATCAGGCGGAAGACGAACTGGGCTTACCTGCTGTCCCCCGGGCCT
 
. : . : . : . : . : . :
rJMSF035L22+ CACTTCGCGGTTAGCTACACTATGCACCACAGTAGTTGACTCCTTCATTTTTCCCTAATG
rJMSF016G14+ CACTTCGCGGTTAGCTACACTATGCACCACAGTAGTTGACTCCTTCATTTTTCCCTAATG
                      ____________________________________________________________
consensus CACTTCGCGGTTAGCTACACTATGCACCACAGTAGTTGACTCCTTCATTTTTCCCTAATG
 
. : . : . : . : . : . :
rJMSF035L22+ TCAAATATTGGTTGGCAAATGCTTGACATAAACCATACTGTGCAGTATACTCC
rJMSF016G14+ TCAAATATTGGTTGGCAAATGCTTGACATAAA-CATACTGTGCAGTATACTCCGAATTTG
                      ____________________________________________________________
consensus TCAAATATTGGTTGGCAAATGCTTGACATAAACCATACTGTGCAGTATACTCCGAATTTG