Previous Contig 011884:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF016G01Sequence216005616 (3)747011884 (3)gb:AF248647_17806663e-78Lycopersicon pennellii glucose acyltransferase (AT) mRNA, complete cds.
JMSF021H20Sequence696005616 (3)gb:AF006078_17608511e-71Solanum berthaultii glucose acyltransferase (pldp15) mRNA, complete cds.775011884 (3)gb:AF006078_17608514e-68Solanum berthaultii glucose acyltransferase (pldp15) mRNA, complete cds.
JMSF050K11Sequence694005616 (3)gb:AF006078_17608511e-71Solanum berthaultii glucose acyltransferase (pldp15) mRNA, complete cds.775011884 (3)gb:AF006078_17608512e-67Solanum berthaultii glucose acyltransferase (pldp15) mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF016G01+ TTATCGAATGGGGCTTTTATCAGACAA
                      ____________________________________________________________
consensus TTATCGAATGGGGCTTTTATCAGACAA
 
. : . : . : . : . : . :
rJMSF016G01+ TCTATACAAGTCCACAAAAGTAAGTTGCAATGGAGATTACATAGGTGAACATCCACAAAA
                      ____________________________________________________________
consensus TCTATACAAGTCCACAAAAGTAAGTTGCAATGGAGATTACATAGGTGAACATCCACAAAA
 
. : . : . : . : . : . :
rJMSF016G01+ TGCAGCATGTCAGTTTGATCTTCAAAGAGTATTAAAGTGTACTGGAAAGATTAACGAGGC
                      ____________________________________________________________
consensus TGCAGCATGTCAGTTTGATCTTCAAAGAGTATTAAAGTGTACTGGAAAGATTAACGAGGC
 
. : . : . : . : . : . :
rJMSF016G01+ GCAAATTTTAGAACCAAAGTGTAGCAATGAAAATTTACTGAGTCTAGATGTGTGCTCTGT
                      ____________________________________________________________
consensus GCAAATTTTAGAACCAAAGTGTAGCAATGAAAATTTACTGAGTCTAGATGTGTGCTCTGT
 
. : . : . : . : . : . :
rJMSF050K11+ TGGTGAAAATTTACCACAACACTGGTGCAGAGAAAATAA
rJMSF021H20+ TGGTGAAAATTTACCACAACACTGGTGCAGAGAAAATAA
rJMSF016G01+ TGGTGAAAATCAAAATCCTACTAGTCTCCTTATACCACAACACTGGTGCAGAGATGATAA
                      ____________________________________________________________
consensus TGGTGAAAATCAAAATCCTACTGGTGAAAATTTACCACAACACTGGTGCAGAGAAAATAA
 
. : . : . : . : . : . :
rJMSF050K11+ TTATTTGTTCTCCTCCACCTGGGCAAATAACAAAGTTGTCCAGAAAGCGCTTCACGTGCA
rJMSF021H20+ TTATTTGTTCTCCTCCACCTGGGCAAATAACAAAGTTGTCCAGAAAGCGCTTCACGTGCA
rJMSF016G01+ TTATTTGTACTCCTACACTTGGGCAAATAACAAAATTGTCCAGGAAGCACTTCATGTTCA
                      ____________________________________________________________
consensus TTATTTGTTCTCCTCCACCTGGGCAAATAACAAAGTTGTCCAGAAAGCGCTTCACGTGCA
 
. : . : . : . : . : . :
rJMSF050K11+ TGAGGGAACGATAACAGAGTGGGTTAGATGCAACCAAAGCATGAAAGGTGA---TACTAA
rJMSF021H20+ TGAGGGAACGATAACAGAGTGGGTTAGATGCAACCAAAGCATGAAAGGTGA---TACTAA
rJMSF016G01+ TGAGGACACAGTGACAGAGTGGGTCAGATGCAATAAAAGCATGAAGTATGATTTTGGTAT
                      ____________________________________________________________
consensus TGAGGGAACGATAACAGAGTGGGTTAGATGCAACCAAAGCATGAAAGGTGA---TACTAA
 
. : . : . : . : . : . :
rJMSF050K11+ TGAGAGAACTGAGGCATACATTTTTAATGTCCAAAGCACAGTTGATTATCATCGGAGTTT
rJMSF021H20+ TGAGAGAACTGAGGCATACATTTTTAATGTCCAAAGCACAGTTGATTATCATCGGAGTTT
rJMSF016G01+ GGAGAGAGCTGAAGCATATGTTTTTAATGTTAAAAGCACAGTTGATTATCATCGGAGTTT
                      ____________________________________________________________
consensus TGAGAGAACTGAGGCATACATTTTTAATGTCCAAAGCACAGTTGATTATCATCGGAGTTT
 
. : . : . : . : . : . :
rJMSF050K11+ CACCAACAAATCTTGTCGAGTTCTAATCTACAGTGGGGATCATGACATGGTTGCACCTCA
rJMSF021H20+ CACCAACAAATCTTGTCGAGTTCTAATCTACAGTGGGGATCATGACATGGTTGCACCTCA
rJMSF016G01+ CATCAACGAATCTTGTCGAGTTCTAATCTACAGTGGGGATCATGACATGATCATTCCTCA
                      ____________________________________________________________
consensus CACCAACAAATCTTGTCGAGTTCTAATCTACAGTGGGGATCATGACATGGTTGCACCTCA
 
. : . : . : . : . : . :
rJMSF050K11+ TCTGGGCACAGAAGAATGGATAGGGTCCTTACAAGTTGCCGTTGAAGATGATTGGAGACC
rJMSF021H20+ TCTGGGCACAGAAGAATGGATAGGGTCCTTACAAGTTGCCGTTGAAGATGATTGGAGACC
rJMSF016G01+ TGTGAGCACGGAAGAATGGATAGAATCCTTAAAAGTTTTGGTTGAAGACGAGTGGAGACC
                      ____________________________________________________________
consensus TCTGGGCACAGAAGAATGGATAGGGTCCTTACAAGTTGCCGTTGAAGATGATTGGAGACC
 
. : . : . : . : . : . :
rJMSF050K11+ TTGGTTTGTTGAAGATCAAGTTGCAGGATACACCATGAAATATTCACAGAATAACTATGA
rJMSF021H20+ TTGGTTTGTTGAAGATCAAGTTGCAGGATACACCATGAAATATTCACAGAATAACTATGA
rJMSF016G01+ TTGGTTTGTTGAAGATCAAGTTGCAGGATACACTATGAAATATTCACAGGAGGACTATGA
                      ____________________________________________________________
consensus TTGGTTTGTTGAAGATCAAGTTGCAGGATACACCATGAAATATTCACAGAATAACTATGA
 
. : . : . : . : . : . :
rJMSF050K11+ GTTGACATATGCAACTGTAAAGGGAGCAGGTCATACAGCACCAGAGTATAAGCCACAACA
rJMSF021H20+ GTTGACATATGCAACTGTAAAGGGAGCAGGTCATACAGCACCAGAGTATAAGCCACAACA
rJMSF016G01+ GTTGACATATGCAACTGTAAAGGGAGCAGGTCATACAGCACCAGAATATAAGCCACAACA
                      ____________________________________________________________
consensus GTTGACATATGCAACTGTAAAGGGAGCAGGTCATACAGCACCAGAGTATAAGCCACAACA
 
. : . : . : . : . : . :
rJMSF050K11+ ATGTCAGTCAATGATTCAGAGATGGCTTAGCAATTATCCTCTTTGATTAT
rJMSF021H20+ ATGTCAGTCAATGATTCAGAGATGGCTTAGCAATTATCCTCTTTGATTAT
rJMSF016G01+ ATGTCAGTCAATGATTCAGAGATGGCTTAGCAATAATCGTCTTTGATTATTATGTAATAT
                      ____________________________________________________________
consensus ATGTCAGTCAATGATTCAGAGATGGCTTAGCAATTATCCTCTTTGATTATTATGTAATAT