Previous Contig 011882:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS153E09Sequence624011882 (6)pir|T48625|T486258e-75pescadillo-like protein - Arabidopsis thaliana>gb:ATT15N1_1554525 Arabidopsis th
JMSF011F16Sequence245005308 (6)gb:AC097368_17366542e-16Oryza sativa chromosome 3 BAC OSJNBb0017F17 genomic sequence, complete sequence.720011882 (6)pir|T48625|T486251e-56pescadillo-like protein - Arabidopsis thaliana>gb:ATT15N1_1554525 Arabidopsis th
JMSF012E22Sequence234005308 (6)gb:AC097368_17366542e-13Oryza sativa chromosome 3 BAC OSJNBb0017F17 genomic sequence, complete sequence.793011882 (6)pir|T48625|T486251e-66pescadillo-like protein - Arabidopsis thaliana>gb:ATT15N1_1554525 Arabidopsis th
JMSF016F19Sequence243005308 (6)gb:AC097368_17366543e-17Oryza sativa chromosome 3 BAC OSJNBb0017F17 genomic sequence, complete sequence.757011882 (6)pir|T48625|T486259e-59pescadillo-like protein - Arabidopsis thaliana>gb:ATT15N1_1554525 Arabidopsis th
JMSF017F15Sequence535005308 (6)gb:AC097368_17366545e-56Oryza sativa chromosome 3 BAC OSJNBb0017F17 genomic sequence, complete sequence.731011882 (6)pir|T48625|T486256e-58pescadillo-like protein - Arabidopsis thaliana>gb:ATT15N1_1554525 Arabidopsis th
JMSF040J24Sequence672005308 (6)gb:AC097368_17366545e-79Oryza sativa chromosome 3 BAC OSJNBb0017F17 genomic sequence, complete sequence.862011882 (6)pir|T48625|T486255e-73pescadillo-like protein - Arabidopsis thaliana>gb:ATT15N1_1554525 Arabidopsis th

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS153E09- TCTGATTTGAGACTTGCACANGCTTC
                      ____________________________________________________________
consensus TCTGATTTGAGACTTGCACANGCTTC
 
. : . : . : . : . : . :
JMFS153E09- AACACCAACTTCCTTCAAATGAGCCAGGTGCTTTAATGCACCTTGTTGAAGAGGCTGCTA
                      ____________________________________________________________
consensus AACACCAACTTCCTTCAAATGAGCCAGGTGCTTTAATGCACCTTGTTGAAGAGGCTGCTA
 
. : . : . : . : . : . :
JMFS153E09- GCATTGATGAAGACGATGCAGAAACAAGGGAATGCAAGGCCCTCTTGAAGGGAATGAGAT
                      ____________________________________________________________
consensus GCATTGATGAAGACGATGCAGAAACAAGGGAATGCAAGGCCCTCTTGAAGGGAATGAGAT
 
. : . : . : . : . : . :
JMFS153E09- TCTTCTTAAGTCGTGAGGTTCCTAGAGAGTCTCTGCTTTTTATCATTCCTGCTTTCGGTG
rJMSF040J24+ CTAGAGAGTCTCTGCTTTTTATCATTCCTGCTTTCGGTG
                      ____________________________________________________________
consensus TCTTCTTAAGTCGTGAGGTTCCTAGAGAGTCTCTGCTTTTTATCATTCCTGCTTTCGGTG
 
. : . : . : . : . : . :
JMFS153E09- GTGTTGTAT-CGTGGGAGGGTGAAGGAGCCCCAATCAAGGAATCTGATCAGAGCATCACT
rJMSF040J24+ GTGTTGTATNCGTGGGAGGGTGAAGGAGCCCCAATCAAGGAATCTGATCAGAGCATCACT
rJMSF012E22+ ATCAAGGANTNTGATCAGAGCATCNCT
                      ____________________________________________________________
consensus GTGTTGTATNCGTGGGAGGGTGAAGGAGCCCCAATCAAGGAATCTGATCAGAGCATCACT
 
. : . : . : . : . : . :
JMFS153E09- CATCAGATTGTTGATAGGCCGACACAGGGGCACAGATTTCTTTCTCGGGAATATGTTCAA
rJMSF040J24+ CATCAGATTGTTGATAGGCCGACACAGGGGCACAGATTTCTTTCTCGGGAATATGTTCAA
rJMSF012E22+ CATCAGATTGTTGATAGGCCGACACAGGGGCACAGATTTCTTTCTCGGGAATATGTTCAA
rJMSF017F15+ GGGAATATGTTCAA
rJMSF011F16+ CAA
rJMSF016F19+ ACACAGGGGCACAGATTTC-TTCTCGGGAATATGTTCAA
                      ____________________________________________________________
consensus CATCAGATTGTTGATAGGCCGACACAGGGGCACAGATTTCTTTCTCGGGAATATGTTCAA
 
. : . : . : . : . : . :
JMFS153E09- CCACAGTGGGTTTTTGATTGTATAAATGCACGCATCATATTGCCAACTGAGGATTACTTT
rJMSF040J24+ CCACAGTGGGTTTTTGATTGTATAAATGCACGCATCATATTGCCAACTGAGGATTACTTT
rJMSF012E22+ CCACAGTGGGTTTTTGATTGTATAAATGCACGCATCATATTGCCAACTGAGGATTACTTT
rJMSF017F15+ CCACAGTGGGTTTTTGATTGTATAAATGCACGCATCATATTGCCAACTGAGGATTACTTT
rJMSF011F16+ CCACAGTGGGTTTTTGATTGTATAAATGCACGCATCATATTGCCAACTGAGGATTACTTT
rJMSF016F19+ CCACAGTGGGTTTTTGATTGTATAAATGCACGCATCATATTGCCAACTGAGGATTACTTT
                      ____________________________________________________________
consensus CCACAGTGGGTTTTTGATTGTATAAATGCACGCATCATATTGCCAACTGAGGATTACTTT
 
. : . : . : . : . : . :
JMFS153E09- GTCGGAAGGGTTCCTCCTCCGCACTTGTCACCTTTTGTTGACAATGAAGCGGAAGGCTAT
rJMSF040J24+ GTCGGAAGGGTTCCTCCTCCGCACTTGTCACCTTTTGTTGACAATGAAGCGGAAGGCTAT
rJMSF012E22+ GTCGGAAGGGTTCCTCCTCCGCACTTGTCACCTTTTGTTGACAATGAAGCGGAAGGCTAT
rJMSF017F15+ GTCGGAAGGGTTCCTCCTCCGCACTTGTCACCTTTTGTTGACAATGAAGCGGAAGGCTAT
rJMSF011F16+ GTCGGAAGGGTTCCTCCTCCGCACTTGTCACCTTTTGTTGACAATGAAGCGGAAGGCTAT
rJMSF016F19+ GTCGGAAGGGTTCCTCCTCCGCACTTGTCACCTTTTGTTGACAATGAAGCGGAAGGCTAT
                      ____________________________________________________________
consensus GTCGGAAGGGTTCCTCCTCCGCACTTGTCACCTTTTGTTGACAATGAAGCGGAAGGCTAT
 
. : . : . : . : . : . :
JMFS153E09- GTCCCTGAATATGCTGAGACCATCAAGCGGCTACAAGCTGCTGCCAGAAGAGAAGTCCTC
rJMSF040J24+ GTCCCTGAATATGCTGAGACCATCAAGCGGCTACAAGCTGCTGCCAGAAGAGAAGTCCTC
rJMSF012E22+ GTCCCTGAATATGCTGAGACCATCAAGCGGCTACAAGCTGCTGCCAGAAGAGAAGTCCTC
rJMSF017F15+ GTCCCTGAATATGCTGAGACCATCAAGCGGCTACAAGCTGCTGCCAGAAGAGAAGTCCTC
rJMSF011F16+ GTCCCTGAATATGCTGAGACCATCAAGCGGCTACAAGCTGCTGCCAGAAGAGAAGTCCTC
rJMSF016F19+ GTCCCTGAATATGCTGAGACCATCAAGCGGCTACAAGCTGCTGCCAGAAGAGAAGTCCTC
                      ____________________________________________________________
consensus GTCCCTGAATATGCTGAGACCATCAAGCGGCTACAAGCTGCTGCCAGAAGAGAAGTCCTC
 
. : . : . : . : . : . :
JMFS153E09- CCAATGCCAGGCGTTGGCATAGAGGATTTGGATGATCCTCAGAATCTACTAGCGGAAGGT
rJMSF040J24+ CCAATGCCAGGCGTTGGCATAGAGGATTTGGATGATCCTCAGAATCTACTAGCGGAAGGT
rJMSF012E22+ CCAATGCCAGGCGTTGGCATAGAGGATTTGGATGATCCTCAGAATCTACTAGCGGAAGGT
rJMSF017F15+ CCAATGCCAGGCGTTGGCATAGAGGATTTGGATGATCCTCAGAATCTACTAGCGGAAGGT
rJMSF011F16+ CCAATGCCAGGCGTTGGCATAGAGGATTTGGATGATCCTCAGAATCTACTAGCGGAAGGT
rJMSF016F19+ CCAATGCCAGGCGTTGGCATAGAGGATTTGGATGATCCTCAGAATCTACTAGCGGAAGGT
                      ____________________________________________________________
consensus CCAATGCCAGGCGTTGGCATAGAGGATTTGGATGATCCTCAGAATCTACTAGCGGAAGGT
 
. : . : . : . : . : . :
JMFS153E09- ATTAGTGACCGTGCAGAAGCTATTGCAGCTGCTCAGAAAAAGCAAAAGATGTCTGCTTT
rJMSF040J24+ ATTAGTGACCGTGCAGAAGCTATTGCAGCTGCTCAGAAAAAGCAAAAGATGTCTGCTTTA
rJMSF012E22+ ATTAGTGACCGTGCAGAAGCTATTGCAGCTGCTCAGAAAAAGCAAAAGATGTCTGCTTTA
rJMSF017F15+ ATTAGTGACCGTGCAGAAGCTATTGCAGCTGCTCAGAAAAAGCAAAAGATGTCTGCTTTA
rJMSF011F16+ ATTAGTGACCGTGCAGAAGCTATTGCAGCTGCTCAGAAAAAGCAAAAGATGTCTGCTTTA
rJMSF016F19+ ATTAGTGACCGTGCAGAAGCTATTGCAGCTGCTCAGAAAAAGCAAAAGATGTCTGCTTTA
                      ____________________________________________________________
consensus ATTAGTGACCGTGCAGAAGCTATTGCAGCTGCTCAGAAAAAGCAAAAGATGTCTGCTTTA
 
. : . : . : . : . : . :
rJMSF040J24+ GAGAAGCAGTATCATGAAGAATTGAAAAGGGAGTTTCAAGGTGCCAAATACTCGACAATT
rJMSF012E22+ GAGAAGCAGTATCATGAAGAATTGAAAAGGGAGTTTCAAGGTGCCAAATACTCGACAATT
rJMSF017F15+ GAGAAGCAGTATCATGAAGAATTGAAAAGGGAGTTTCAAGGTGCCAAATACTCGACAATT
rJMSF011F16+ GAGAAGCAGTATCATGAAGAATTGAAAAGGGAGTTTCAAGGTGCCAAATACTCGACAATT
rJMSF016F19+ GAGAAGCAGTATCATGAAGAATTGAAAAGGGAGTTTCAAGGTGCCAAATACTCGACAATT
                      ____________________________________________________________
consensus GAGAAGCAGTATCATGAAGAATTGAAAAGGGAGTTTCAAGGTGCCAAATACTCGACAATT
 
. : . : . : . : . : . :
rJMSF040J24+ TCCAGTGAGAGTAAGGACGCTCCCGAGGACAACAATGCTAATACTGAATCAGTTCCTGAT
rJMSF012E22+ TCCAGTGAGAGTAAGGACGCTCCCGAGGACAACAATGCTAATACTGAATCAGTTCCTGAT
rJMSF017F15+ TCCAGTGAGAGTAAGGACGCTCCCGAGGACAACAATGCTAATACTGAATCAGTTCCTGAT
rJMSF011F16+ TCCAGTGAGAGTAAGGACGCTCCCGAGGACAACAATGCTAATACTGAATCAGTTCCTGAT
rJMSF016F19+ TCCAGTGAGAGTAAGGACGCTCCCGAGGACAACAATGCTAATACTGAATCAGTTCCTGAT
                      ____________________________________________________________
consensus TCCAGTGAGAGTAAGGACGCTCCCGAGGACAACAATGCTAATACTGAATCAGTTCCTGAT
 
. : . : . : . : . : . :
rJMSF040J24+ GAGCAACAAATTGCCAAGGATGCTGACAACATGTCTAAAATGGTGATGTCTCGCAAAAGG
rJMSF012E22+ GAGCAACAAATTGCCAAGGATGCTGACAACATGTCTAAAATGGTGATGTCTCGCAAAAGG
rJMSF017F15+ GAGCAACAAATTGCCAAGGATGCTGACAACATGTCTAAAATGGTGATGTCTCGCAAAAGG
rJMSF011F16+ GAGCAACAAATTGCCAAGGATGCTGACAACATGTCTAAAATGGTGATGTCTCGCAAAAGG
rJMSF016F19+ GAGCAACAAATTGCCAAGGATGCTGACAACATGTCTAAAATGGTGATGTCTCGCAAAAGG
                      ____________________________________________________________
consensus GAGCAACAAATTGCCAAGGATGCTGACAACATGTCTAAAATGGTGATGTCTCGCAAAAGG
 
. : . : . : . : . : . :
rJMSF040J24+ AGAAACATCTTGGAGGCTGCAGAGATTGGCAGGAAACGGAAAAAGGATAAGGTTGCTCGG
rJMSF012E22+ AGAAACATCTTGGAGGCTGCAGAGATTGGCAGGAAACGGAAAAAGGATAAGGTTGCTCGG
rJMSF017F15+ AGAAACATCTTGGAGGCTGCAGAGATTGGCAGGAAACGGAAAAAGGATAAGGTTGCTCGG
rJMSF011F16+ AGAAACATCTTGGAGGCTGCAGAGATTGGCAGGAAACGGAAAAAGGATAAGGTTGCTCGG
rJMSF016F19+ AGAAACATCTTGGAGGCTGCAGAGATTGGCAGGAAACGGAAAAAGGATAAGGTTGCTCGG
                      ____________________________________________________________
consensus AGAAACATCTTGGAGGCTGCAGAGATTGGCAGGAAACGGAAAAAGGATAAGGTTGCTCGG
 
. : . : . : . : . : . :
rJMSF040J24+ TTGGAGGAAAGGAGGAAAACTTTAAAGAACTCCAAGAAATCTGAAACCAGCTAGGTGCCT
rJMSF012E22+ TTGGAGGAAAGGAGGAAAACTTTAAAGAACTCCAAGAAATCTGAAACCAGCTAGGTGCCT
rJMSF017F15+ TTGGAGGAAAGGAGGAAAACTTTAAAGAACTCCAAGAAATCTGAAACCAGCTAGGTGCCT
rJMSF011F16+ TTGGAGGAAAGGAGGAAAACTTTAAAGAACTCCAAGAAATCTGAAACCAGCTAGGTGCCT
rJMSF016F19+ TTGGAGGAAAGGAGGAAAACTTTAAAGAACTCCAAGAAATCTGAAACCAGCTAGGTGCCT
                      ____________________________________________________________
consensus TTGGAGGAAAGGAGGAAAACTTTAAAGAACTCCAAGAAATCTGAAACCAGCTAGGTGCCT
 
. : . : . : . : . : . :
rJMSF040J24+ TCATATGCTGTACTGTATTGTTTTCTGATCTGTTCTATATGCCTTGACTGGCACAGAAGT
rJMSF012E22+ TCATATGCTGTACTGTATTGTTTTCTGATCTGTTCTATATGCCTTGACTGGCACAGAAGT
rJMSF017F15+ TCATATGCTGTACTGTATTGTTTTCTGATCTGTTCTATATGCCTTGACTGGCACAGAAGT
rJMSF011F16+ TCATATGCTGTACTGTATTGTTTTCTGATCTGTTCTATATGCCTTGACTGGCACAGAAGT
rJMSF016F19+ TCATATGCTGTACTGTATTGTTTTCTGATCTGTTCTATATGCCTTGACTGGCACAGAAGT
                      ____________________________________________________________
consensus TCATATGCTGTACTGTATTGTTTTCTGATCTGTTCTATATGCCTTGACTGGCACAGAAGT
 
. : . : . : . : . : . :
rJMSF040J24+ TTTGCCTTAGGGTAAGTTTAAACAACCATATGGTAGAGGATTG
rJMSF012E22+ TTTGCCTTAGGGTAAGTTTAAACAA-CATATGGTAGAGGATTGAT
rJMSF017F15+ TTTGCCNTAGGGTAAGTTTAAACAA-CATATGGTAGAGGATTGATTACTCCT
rJMSF011F16+ TTTGCCTTAGGGTAAGTTTAAACAA-CATATGGTAGAGGATTGATTACTCCT
rJMSF016F19+ TTTGCCTTAGGGTAAGTTTAAACAA-CATATGGTAGAGGATTGATTACTCCTTGTCAATA
                      ____________________________________________________________
consensus TTTGCCTTAGGGTAAGTTTAAACAA-CATATGGTAGAGGATTGATTACTCCTTGTCAATA