Previous Contig 011876:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFN038H02Sequence509011876 (2)gb:PTY13771_17028445e-22Populus trichocarpa mRNA for laccase, lac3 gene.
JMSF016E10Sequence240018975pir|JC5229|JC52298e-14laccase (EC 1.10.3.2) precursor - common tobacco>gb:A68085_1450338 Sequence 1 fr757011876 (2)gb:PTY13771_1702844e-105Populus trichocarpa mRNA for laccase, lac3 gene.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFN038H02+ TTTTTTTGAAAATCAATGGAACATGAATAAGCATGTCACTAAAAATTGTAAAACA
                      ____________________________________________________________
consensus TTTTTTTGAAAATCAATGGAACATGAATAAGCATGTCACTAAAAATTGTAAAACA
 
. : . : . : . : . : . :
JMFN038H02+ CAAATACACATCAGAAAATCCTTCTATATATTTCCATACTTTTAAAGAAAACAAGAAAAC
                      ____________________________________________________________
consensus CAAATACACATCAGAAAATCCTTCTATATATTTCCATACTTTTAAAGAAAACAAGAAAAC
 
. : . : . : . : . : . :
JMFN038H02+ ATTACAAACTTAAACAGTAACAATTATCAAGAACCTTCAAAGGTTTTCATGAAATTAAAT
                      ____________________________________________________________
consensus ATTACAAACTTAAACAGTAACAATTATCAAGAACCTTCAAAGGTTTTCATGAAATTAAAT
 
. : . : . : . : . : . :
JMFN038H02+ TTTTGTCAATGCTTCCCCACAAACAAATCTTTGTCTCCTAACTCTTTTATTCATCAAAAG
                      ____________________________________________________________
consensus TTTTGTCAATGCTTCCCCACAAACAAATCTTTGTCTCCTAACTCTTTTATTCATCAAAAG
 
. : . : . : . : . : . :
JMFN038H02+ TTGTTCTTTTTTTTTTATTTTTTTTTCTTGACCTCAGCTCCCATGAATAACCAGACAGAG
                      ____________________________________________________________
consensus TTGTTCTTTTTTTTTTATTTTTTTTTCTTGACCTCAGCTCCCATGAATAACCAGACAGAG
 
. : . : . : . : . : . :
JMFN038H02+ CTTTGGTTGTTTTCATCAACAACTAGGCAGGTCACTAGGAGGAGGCAGGATTGATTCATT
rJMSF016E10- GGCAGGTCACTTGGAGGAGGAAGGATGGATTCATT
                      ____________________________________________________________
consensus CTTTGGTTGTTTTCATCAACAACTAGGCAGGTCACTTGGAGGAGGCAGGATTGATTCATT
 
. : . : . : . : . : . :
JMFN038H02+ AGGGCCCTTCCCATTGTCCACCAAAAA-GCCATTTTGAGTCCCCATGTTGTATGCACTTC
rJMSF016E10- GGGGCCCTTACCATTTTCCACCAAAAATGCCATCTTTAGTCCCCATGTTGTATGGATTTC
                      ____________________________________________________________
consensus GGGGCCCTTCCCATTTTCCACCAAAAATGCCATTTTTAGTCCCCATGTTGTATGGATTTC
 
. : . : . : . : . : . :
JMFN038H02+ TAGATGACAGTGCAGAAACCAAACCCCGGGGTTATCTGCTCTGAATCTGATGGCAGTCCA
rJMSF016E10- CAGATGACAATGCATAAACCAAACACCTGGATTATCTGCTCTGAATCTGATGGCAGTCCA
                      ____________________________________________________________
consensus TAGATGACAGTGCATAAACCAAACCCCTGGGTTATCTGCTCTGAATCTGATGGCAGTCCA
 
. : . : . : . : . : . :
rJMSF016E10- GCCAGCTGTAGGTACGCTGACTGTGTTCCTTTCGACAGGGTCAATCAGATTGAATTTCTT
                      ____________________________________________________________
consensus GCCAGCTGTAGGTACGCTGACTGTGTTCCTTTCGACAGGGTCAATCAGATTGAATTTCTT
 
. : . : . : . : . : . :
rJMSF016E10- GGGGTCGTTTTGGGGATCAAAGTTTCCGAGTCCTTTTCCAACAACATAGAAATTGAAACC
                      ____________________________________________________________
consensus GGGGTCGTTTTGGGGATCAAAGTTTCCGAGTCCTTTTCCAACAACATAGAAATTGAAACC
 
. : . : . : . : . : . :
rJMSF016E10- ATGCAAATGGGTTGGATGGCTTTCTGGTGCAATAATAGAAGTGCCTTGGATCACAATCTG
                      ____________________________________________________________
consensus ATGCAAATGGGTTGGATGGCTTTCTGGTGCAATAATAGAAGTGCCTTGGATCACAATCTG
 
. : . : . : . : . : . :
rJMSF016E10- AACAGTCGAGTTAAACCCCAATCTGTAAACCTTTGTGCCATTCTGTGTCTGCATATTTGC
                      ____________________________________________________________
consensus AACAGTCGAGTTAAACCCCAATCTGTAAACCTTTGTGCCATTCTGTGTCTGCATATTTGC
 
. : . : . : . : . : . :
rJMSF016E10- TGGTGGAGTGCCCGTGTAGTTGAAAGGAATTCGAGGCTTTCCGGGAAAATCATCTGTGAA
                      ____________________________________________________________
consensus TGGTGGAGTGCCCGTGTAGTTGAAAGGAATTCGAGGCTTTCCGGGAAAATCATCTGTGAA
 
. : . : . : . : . : . :
rJMSF016E10- AACTCCACTTATGTTATAGTAATGAGCTTGAAGGAGAGGTGTAGTAGGCATGACAAAGCT
                      ____________________________________________________________
consensus AACTCCACTTATGTTATAGTAATGAGCTTGAAGGAGAGGTGTAGTAGGCATGACAAAGCT
 
. : . : . : . : . : . :
rJMSF016E10- GACGTTGTTGATATCTGCAACGACCCGGGATCCACTGGAGCAAGCAGGGCATGGATTGAC
                      ____________________________________________________________
consensus GACGTTGTTGATATCTGCAACGACCCGGGATCCACTGGAGCAAGCAGGGCATGGATTGAC
 
. : . : . : . : . : . :
rJMSF016E10- ACCAACACCAATCGCGAAAACCAGAGAATGGTCAACACTCAGCGGGACGTTTGCAGGGTA
                      ____________________________________________________________
consensus ACCAACACCAATCGCGAAAACCAGAGAATGGTCAACACTCAGCGGGACGTTTGCAGGGTA