Previous Contig 011872:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF015H22Sequence120014367128011872 (3)
JMFS066B07Sequence621011872 (3)gb:AF132001_17708447e-12Petunia x hybrida PHAP2A protein (Ap2A) mRNA, complete cds.
JMSF016D10Sequence139018972758011872 (3)gb:AF132001_17708444e-11Petunia x hybrida PHAP2A protein (Ap2A) mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF016D10+ CGGCCGTGAAATGGTGGGGAGCATAGGGCTCAGAACTCT
                      ____________________________________________________________
consensus CGGCCGTGAAATGGTGGGGAGCATAGGGCTCAGAACTCT
 
. : . : . : . : . : . :
rJMSF016D10+ TCACTATTGCAATTTGAACTCAATTGGTGGCACCAAGGTGGCCTAAGGCCGCCTAAGGAG
                      ____________________________________________________________
consensus TCACTATTGCAATTTGAACTCAATTGGTGGCACCAAGGTGGCCTAAGGCCGCCTAAGGAG
 
. : . : . : . : . : . :
JMFS066B07- AGGGAGGGGTACAACGAGACAGAAACGTTGCAG
rJMSF016D10+ CATGGTGGTAGTGATGATGGGCGGAGAAGGGAGGGGTACAACGAGACAGAAACGTTGCAG
                      ____________________________________________________________
consensus CATGGTGGTAGTGATGATGGGCGGAGAAGGGAGGGGTACAACGAGACAGAAACGTTGCAG
 
. : . : . : . : . : . :
JMFS066B07- CAACTAAGCCAAACACACCTTAATTCTCCAGGCTCAAGAAAGGCTAATAACAACACAGGT
rJMSF016D10+ CAANTAAGCCAAACACACCTTAATTCTCCAGGCTCAAGAAAGGCTAATAACAACACAGGT
                      ____________________________________________________________
consensus CAACTAAGCCAAACACACCTTAATTCTCCAGGCTCAAGAAAGGCTAATAACAACACAGGT
 
. : . : . : . : . : . :
JMFS066B07- AGTAGCAGTGAAATGCTGAGATTTGGGCATTTCATGACTCCTCCTCAGATGTTCCCACCA
rJMSF016D10+ AGTAGCAGTGAAATGCTGAGATTTGGGCATTTCATGACTCCTCCTCAGATGTTCCCACCA
                      ____________________________________________________________
consensus AGTAGCAGTGAAATGCTGAGATTTGGGCATTTCATGACTCCTCCTCAGATGTTCCCACCA
 
. : . : . : . : . : . :
JMFS066B07- CAGTTCAGCTAAGTCAAAAAAACTCTATCATCAGCTTCCCAGCAGCAGCAGCAATGGAGG
rJMSF016D10+ CAGTTCAGCTAAGTCAAAAAAACTCTATCATCAGCTTCCCAGCAGCAGCAGCAATGGAGG
                      ____________________________________________________________
consensus CAGTTCAGCTAAGTCAAAAAAACTCTATCATCAGCTTCCCAGCAGCAGCAGCAATGGAGG
 
. : . : . : . : . : . :
JMFS066B07- CTGCATTATATTGGATCAACCACAGATCAATCATATATATATATATATACATCAAACAAT
rJMSF016D10+ NTGCATTATATTGGATCAACCACAGATCAATCATATATATATATATATACATCAAACAAT
                      ____________________________________________________________
consensus CTGCATTATATTGGATCAACCACAGATCAATCATATATATATATATATACATCAAACAAT
 
. : . : . : . : . : . :
JMFS066B07- GGCGGTTCCAATATAATCATCCTCCCTCTAACACCTGCAACTACTGCTGCAGCATCATCA
rJMSF016D10+ GGCGGTTCCAATATAATCATCCTCCCTCTAACACCTGCAACTACTGCTGCAGCATCATCA
                      ____________________________________________________________
consensus GGCGGTTCCAATATAATCATCCTCCCTCTAACACCTGCAACTACTGCTGCAGCATCATCA
 
. : . : . : . : . : . :
rJMFF015H22+ CGAAAAACCGGGTTCCATTGTTCCTCCATT
JMFS066B07- GGATTCCCTCACCAGCATCATCGGCCTTCGCGAAAAACCGGGTTCCATTGTTCCTCCATT
rJMSF016D10+ GGATTCCCTCACCAGCATCATCGGCCTTCGCGAAAAACCGGGTTCCATTGTTCCTCCATT
                      ____________________________________________________________
consensus GGATTCCCTCACCAGCATCATCGGCCTTCGCGAAAAACCGGGTTCCATTGTTCCTCCATT
 
. : . : . : . : . : . :
rJMFF015H22+ AAACCACCTTGGGATTAATATCATTTCTTGACAGTTNGAGTTTCTTCTTTGCCATCCAAT
JMFS066B07- AAACCACCTT-GGATTAATATCATTTCTTGACAGTTTGAGTTTCTTCTTTGCCATCCAAT
rJMSF016D10+ AAACCACCTT-GGATTAATATCATTTCTTGACAGTTTGAGTTTCTTCTTTGCCATCCAAT
                      ____________________________________________________________
consensus AAACCACCTT-GGATTAATATCATTTCTTGACAGTTTGAGTTTCTTCTTTGCCATCCAAT
 
. : . : . : . : . : . :
rJMFF015H22+ TCCTCCTTACCAGCTCCCATCCTTTCTCTGATCTTCAC
JMFS066B07- TCCTCCTTACCAGCTCCCATCCTTTCTCTGATCTTCAC
rJMSF016D10+ TCCTCCTTACCAGCTCCCATCCTTTCTCTGATCTTCACCGTTGTTGTAAAGGCTGCTATT
                      ____________________________________________________________
consensus TCCTCCTTACCAGCTCCCATCCTTTCTCTGATCTTCACCGTTGTTGTAAAGGCTGCTATT
 
. : . : . : . : . : . :
rJMSF016D10+ TTATTACTGTCTTCCATAGCTAGTAAATTTCAAGCTGTTGATCGAGGCATTCAAATTTGG
                      ____________________________________________________________
consensus TTATTACTGTCTTCCATAGCTAGTAAATTTCAAGCTGTTGATCGAGGCATTCAAATTTGG
 
. : . : . : . : . : . :
rJMSF016D10+ AAGTAATTATTGTTGCTCAAAACTAACCAATTTTACTATGCAATTCTCAATACTCAACAT
                      ____________________________________________________________
consensus AAGTAATTATTGTTGCTCAAAACTAACCAATTTTACTATGCAATTCTCAATACTCAACAT