Previous Contig 011869:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF001H17Sequence385004323 (6)gb:AC104709_17377759e-16Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1214_E03, complete s730011869 (4)gb:NTA244024_16912795e-82Nicotiana tabacum mRNA for phragmoplastin, dynamin-like protein.
JMSF011I18Sequence378004323 (6)gb:AC104709_17377753e-28Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1214_E03, complete s754011869 (4)gb:NTA244024_16912792e-86Nicotiana tabacum mRNA for phragmoplastin, dynamin-like protein.
JMSF016C22Sequence255004323 (6)gb:AC104709_17377751e-10Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1214_E03, complete s786011869 (4)gb:NTA244024_16912795e-84Nicotiana tabacum mRNA for phragmoplastin, dynamin-like protein.
JMSF036C15Sequence683004323 (6)gb:AC104709_17377752e-90Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1214_E03, complete s786011869 (4)gb:NTA244024_16912791e-84Nicotiana tabacum mRNA for phragmoplastin, dynamin-like protein.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF001H17+ GTT
rJMSF011I18+ CAGCTGATGCTTCTGTTGATGCAGTT
rJMSF016C22+ GATGCAGTT
                      ____________________________________________________________
consensus CAGCTGATGCTTCTGTTGATGCAGTT
 
. : . : . : . : . : . :
rJMSF001H17+ CATGGTATACTGANGGATCTGGTTCACAAGTCAATAAGTGAAACTATGGAGTTGAAGCAG
rJMSF011I18+ CATGGTATACTGAAGGATCTGGTTCACAAGTCAATAAGTGAAACTATGGAGTTGAAGCAG
rJMSF036C15+ TACTGAAGGATCTGGTTCACAAGTCAATAAGTGAAACTATGGAGTTGAAGCAG
rJMSF016C22+ CATGGTATACTGAAGGATCTGGTTCACAAGTCAATAAGTGAAACTATGGAGTTGAAGCAG
                      ____________________________________________________________
consensus CATGGTATACTGAAGGATCTGGTTCACAAGTCAATAAGTGAAACTATGGAGTTGAAGCAG
 
. : . : . : . : . : . :
rJMSF001H17+ TACCCTTCTCTTAGAGTGGAGGTCAGTAATGCGGCTGTTGAATCATTAGAAAGAATGAGG
rJMSF011I18+ TACCCTTCTCTTAGAGTGGAGGTCAGTAATGCGGCTGTTGAATCATTAGAAAGAATGAGG
rJMSF036C15+ TACCCTTCTCTTAGAGTGGAGGTCAGTAATGCGGCTGTTGAATCATTAGAAAGAATGAGG
rJMSF016C22+ TACCCTTCTCNTAGAGTGGAGGTCAGTAATGCGGCTGTTGAATCATTAGAAAGAATGAGG
                      ____________________________________________________________
consensus TACCCTTCTCTTAGAGTGGAGGTCAGTAATGCGGCTGTTGAATCATTAGAAAGAATGAGG
 
. : . : . : . : . : . :
rJMSF001H17+ GATGAAAGCAAGAAAGCAACTCTACAGCTTGTTGAAATGGAGTGCAGTTACCTGACTGTA
rJMSF011I18+ GATGAAAGCAAGAAAGCAACTCTACAGCTTGTTGAAATGGAGTGCAGTTACCTGACTGTA
rJMSF036C15+ GATGAAAGCAAGAAAGCAACTCTACAGCTTGTTGAAATGGAGTGCAGTTACCTGACTGTA
rJMSF016C22+ GATGAAAGCAAGAAAGCAACTCTACAGCTTGTTGAAATGGAGTGCAGTTACCTGACTGTA
                      ____________________________________________________________
consensus GATGAAAGCAAGAAAGCAACTCTACAGCTTGTTGAAATGGAGTGCAGTTACCTGACTGTA
 
. : . : . : . : . : . :
rJMSF001H17+ GATNTCTTCCGAAAGCTTCCTCAAGATATTGAGAAGGGTGGAAATCCAACCCATTCAATT
rJMSF011I18+ GATTTCTTCCGAAAGCTTCCTCAAGATATTGAGAAGGGTGGAAATCCAACCCATTCAATT
rJMSF036C15+ GATTTCTTCCGAAAGCTTCCTCAAGATATTGAGAAGGGTGGAAATCCAACCCATTCAATT
rJMSF016C22+ GATTTCTTCCGAAAGCTTCCTCAAGATATTGAGAAGGGTGGAAATCCAACCCATTCAATT
                      ____________________________________________________________
consensus GATTTCTTCCGAAAGCTTCCTCAAGATATTGAGAAGGGTGGAAATCCAACCCATTCAATT
 
. : . : . : . : . : . :
rJMSF001H17+ TTTGATAGATACAACGACTCCTATCTCCGGAGAATTGGATCAAATGTTTTGTCTTATGTC
rJMSF011I18+ TTTGATAGATACAACGACTCCTATCTCCGGAGAATTGGATCAAATGTTTTGTCTTATGTC
rJMSF036C15+ TTTGATAGATACAACGACTCCTATCTCCGGAGAATTGGATCAAATGTTTTGTCTTATGTC
rJMSF016C22+ TTTGATAGATACAACGACTCCTATCTCCGGAGAATTGGATCAAATGTTTTGTCTTATGTC
                      ____________________________________________________________
consensus TTTGATAGATACAACGACTCCTATCTCCGGAGAATTGGATCAAATGTTTTGTCTTATGTC
 
. : . : . : . : . : . :
rJMSF001H17+ AATATGGTTTGTGCAAGTTTGAGGAATTCCATTCCGAAGTCTATTGTTTATTGTCAAGTA
rJMSF011I18+ AATATGGTTTGTGCAAGTTTGAGGAATTCCATTCCGAAGTCTATTGTTTATTGTCAAGTA
rJMSF036C15+ AATATGGTTTGTGCAAGTTTGAGGAATTCCATTCCGAAGTCTATTGTTTATTGTCAAGTA
rJMSF016C22+ AATATGGTTTGTGCAAGTTTGAGGAATTCCATTCCGAAGTCTATTGTTTATTGTCAAGTA
                      ____________________________________________________________
consensus AATATGGTTTGTGCAAGTTTGAGGAATTCCATTCCGAAGTCTATTGTTTATTGTCAAGTA
 
. : . : . : . : . : . :
rJMSF001H17+ CGAGAGGCCAAACGCAGTTTGCTTGATCATTTCTTCGCTGATTTAGGCAAAAAGGAGGGT
rJMSF011I18+ CGAGAGGCCAAACGCAGTTTGCTTGATCATTTCTTCGCTGATTTAGGCAAAAAGGAGGGT
rJMSF036C15+ CGAGAGGCCAAACGCAGTTTGCTTGATCATTTCTTCGCTGATTTAGGCAAAAAGGAGGGT
rJMSF016C22+ CGAGAGGCCAAACGCAGTTTGCTTGATCATTTCTTCGCTGATTTAGGCAAAAAGGAGGGT
                      ____________________________________________________________
consensus CGAGAGGCCAAACGCAGTTTGCTTGATCATTTCTTCGCTGATTTAGGCAAAAAGGAGGGT
 
. : . : . : . : . : . :
rJMSF001H17+ AAACAACTAGGTAAACTTTTGGATGAGGATCCAGCGGTTATGCAGAGACGTATCTCTTTG
rJMSF011I18+ AAACAACTAGGTAAACTTTTGGATGAGGATCCAGCGGTTATGCAGAGACGTATCTCTTTG
rJMSF036C15+ AAACAACTAGGTAAACTTTTGGATGAGGATCCAGCGGTTATGCAGAGACGTATCTCTTTG
rJMSF016C22+ AAACAACTAGGTAAACTTTTGGATGAGGATCCAGCGGTTATGCAGAGACGTATCTCTTTG
                      ____________________________________________________________
consensus AAACAACTAGGTAAACTTTTGGATGAGGATCCAGCGGTTATGCAGAGACGTATCTCTTTG
 
. : . : . : . : . : . :
rJMSF001H17+ GGAAAGAGATTGGAGCTGTACAGAGCTGCTCAAGCAGAGATTGATTCCGTCGCATGGTCA
rJMSF011I18+ GGAAAGAGATTGGAGCTGTACAGAGCTGCTCAAGCAGAGATTGATTCCGTCGCATGGTCA
rJMSF036C15+ GGAAAGAGATTGGAGCTGTACAGAGCTGCTCAAGCAGAGATTGATTCCGTCGCATGGTCA
rJMSF016C22+ GGAAAGAGATTGGAGCTGTACAGAGCTGCTCAAGCAGAGATTGATTCCGTCGCATGGTCA
                      ____________________________________________________________
consensus GGAAAGAGATTGGAGCTGTACAGAGCTGCTCAAGCAGAGATTGATTCCGTCGCATGGTCA
 
. : . : . : . : . : . :
rJMSF001H17+ AAATAAACATGAACTCTTCTTATCTCAAGCAGAGATTGATTCTATTTGTTGGGATTGGGA
rJMSF011I18+ AAATAAACATGAACTCTTCTTATCTCAAGCAGAGATTGATTCTATTTGTTGGGATTGGGA
rJMSF036C15+ AAATAAACATGAACTCTTCTTATCTCAAGCAGAGATTGATTCTATTTGTTGGGATTGGGA
rJMSF016C22+ AAATAAACATGAACTCTTCTTATCTCAAGCAGAGATTGATTCTATTTGTTGGGATTGGGA
                      ____________________________________________________________
consensus AAATAAACATGAACTCTTCTTATCTCAAGCAGAGATTGATTCTATTTGTTGGGATTGGGA
 
. : . : . : . : . : . :
rJMSF001H17+ TAGTGTTAAGAGACGTTTGATTCTTTGCCTCGACATCTTGTCTTCCTTAAGCAGCTATCT
rJMSF011I18+ TAGTGTTAAGAGACGTTTGATTCTTTGCCTCGACATCTTGTCTTCCTTAAGCAGCTATCT
rJMSF036C15+ TAGTGTTAAGAGACGTTTGATTCTTTGCCTCGACATCTTGTCTTCCTTAAGCAGCTATCT
rJMSF016C22+ TAGTGTTAAGAGACGTTTGATTCTTTGCCTCGACATCTTGTCTTCCTTAAGCAGCTATCT
                      ____________________________________________________________
consensus TAGTGTTAAGAGACGTTTGATTCTTTGCCTCGACATCTTGTCTTCCTTAAGCAGCTATCT
 
. : . : . : . : . : . :
rJMSF001H17+ CACTATCTGCTGACGATTTTCCAGTGCTAAAAAGTAAAAA-CAGAATGTATTTTT
rJMSF011I18+ CACTATCTGCTGACGATTTTCCAGTGCTAAAAAGTAAAAA-CAGAATGTATTTTT
rJMSF036C15+ CACTATCTGCTGACGATTTTCCAGTGCTAAAAAGTAAAAACCAGAATGTATTTTTTGGAA
rJMSF016C22+ CACTATCTGCTGACGATTTTCCAGTGCTAAAAAGTAAAAA-CAGAATGTATTTTTTGGAA
                      ____________________________________________________________
consensus CACTATCTGCTGACGATTTTCCAGTGCTAAAAAGTAAAAA-CAGAATGTATTTTTTGGAA
 
. : . : . : . : . : . :
rJMSF036C15+ CCAAGGCTATTGTATCCAGTGTTAGTTTTAATAC
rJMSF016C22+ -CAAGGCTATTGTAT-CAGTGTTAGTTTTAATACATATACTGACATATTGAGTGTATAAG
                      ____________________________________________________________
consensus CCAAGGCTATTGTATCCAGTGTTAGTTTTAATACATATACTGACATATTGAGTGTATAAG