Previous Contig 011868:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF003L13Sequence382000149 (11)691011868 (2)pir|T06635|T066355e-36hypothetical protein T20K18.120 - Arabidopsis thaliana>gb:ATCHRIV34_1545041 Arab
JMSF016C05Sequence375000149 (11)787011868 (2)gb:AP002870_18234982e-52Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P045

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF016C05+ CAGGAAG
                      ____________________________________________________________
consensus CAGGAAG
 
. : . : . : . : . : . :
rJMSF016C05+ AAAGACATAGGATTGCGGAGACTTTGGATATTGAAATCAAGCGATGGGCTGCTGGGAAGG
                      ____________________________________________________________
consensus AAAGACATAGGATTGCGGAGACTTTGGATATTGAAATCAAGCGATGGGCTGCTGGGAAGG
 
. : . : . : . : . : . :
rJMSF003L13+ TGCAATATGTTCTTTGGCCTGAATGTGGTT
rJMSF016C05+ AAGGAAATCTGCGTGCACTTCTATCAACTCTGCAATATGTTCTTTGGCCTGAATGTGGTT
                      ____________________________________________________________
consensus AAGGAAATCTGCGTGCACTTCTATCAACTCTGCAATATGTTCTTTGGCCTGAATGTGGTT
 
. : . : . : . : . : . :
rJMSF003L13+ GGCACCCTGTTTCCTTGACAGACTTGATTACCGGTGCATCTGTCAAGAAAGTATATAGAA
rJMSF016C05+ GGCACCCTGTTTCCTTGACAGACTTGATTACCGGTGCATCTGTCAAGAAAGTATATAGAA
                      ____________________________________________________________
consensus GGCACCCTGTTTCCTTGACAGACTTGATTACCGGTGCATCTGTCAAGAAAGTATATAGAA
 
. : . : . : . : . : . :
rJMSF003L13+ AAGCAACCCTTTGTATACATCCTGATAAGGTGCAACAGAAAGGTGCTACTCTTCAGCAGA
rJMSF016C05+ AAGCAACCCTTTGTATACATCCTGATAAGGTGCAACAGAAAGGTGCTACTCTTCAGCAGA
                      ____________________________________________________________
consensus AAGCAACCCTTTGTATACATCCTGATAAGGTGCAACAGAAAGGTGCTACTCTTCAGCAGA
 
. : . : . : . : . : . :
rJMSF003L13+ AATATATTGCTGAGAAGGTCTTTGATCTCCTGAAGGAAGCATGGAACAAATTTAACTCGG
rJMSF016C05+ AATATATTGCTGAGAAGGTCTTTGATCTCCTGAAGGAAGCATGGAACAAATTTAACTCGG
                      ____________________________________________________________
consensus AATATATTGCTGAGAAGGTCTTTGATCTCCTGAAGGAAGCATGGAACAAATTTAACTCGG
 
. : . : . : . : . : . :
rJMSF003L13+ AGGAGCTTTTCTAGATCTACATTCATTGATTACTTTTGAATGGCTCTTGGACTACTATCT
rJMSF016C05+ AGGAGCTTTTCTAGATCTACATTCATTGATTACTTTTGAATGGCTCTTGGACTACTATCT
                      ____________________________________________________________
consensus AGGAGCTTTTCTAGATCTACATTCATTGATTACTTTTGAATGGCTCTTGGACTACTATCT
 
. : . : . : . : . : . :
rJMSF003L13+ ATAGAAGTTGTGTGCACAGTTACCAGAGATGCTCATGCTATGATGCCCACAATTTTTTCG
rJMSF016C05+ ATAGAAGTTGTGTGCACAGTTACCAGAGATGCTCATGCTATGATGCCCACAATTTTTTCG
                      ____________________________________________________________
consensus ATAGAAGTTGTGTGCACAGTTACCAGAGATGCTCATGCTATGATGCCCACAATTTTTTCG
 
. : . : . : . : . : . :
rJMSF003L13+ TGCCCATTGGTGTTGGATCTTGCTTCTTGCAAGCTGCTGGTATGGGGTGAAGCATTTGTA
rJMSF016C05+ TGCCCATTGGTGTTGGATCTTGCTTCTTGCAAGCTGCTGGTATGGGGTGAAGCATTTGTA
                      ____________________________________________________________
consensus TGCCCATTGGTGTTGGATCTTGCTTCTTGCAAGCTGCTGGTATGGGGTGAAGCATTTGTA
 
. : . : . : . : . : . :
rJMSF003L13+ GCTGCTGCTGAGATGCATGGTAAAGTAAAATATACGACCGTTGTAAATTGTTTCAATGCC
rJMSF016C05+ GCTGCTGCTGAGATGCATGGTAAAGTAAAATATACGACCGTTGTAAATTGTTTCAATGCC
                      ____________________________________________________________
consensus GCTGCTGCTGAGATGCATGGTAAAGTAAAATATACGACCGTTGTAAATTGTTTCAATGCC
 
. : . : . : . : . : . :
rJMSF003L13+ AGAGAGGGGTTATACGGCATTTGAAGTGACTGGTTGGTGTAGACTAGTATTATATCCAAT
rJMSF016C05+ AGAGAGGGGTTATACGGCATTTGAAGTGACTGGTTGGTGTAGACTAGTATTATATCCAAT
                      ____________________________________________________________
consensus AGAGAGGGGTTATACGGCATTTGAAGTGACTGGTTGGTGTAGACTAGTATTATATCCAAT
 
. : . : . : . : . : . :
rJMSF003L13+ CTTCCTGTGCTTCTATGTCACATTTGATTGCCCACTTCATCTGCATCAGATGATTATTTT
rJMSF016C05+ CTTCCTGTGCTTCTATGTCACATTTGATTGCCCACTTCATCTGCATCAGATGATTATTTT
                      ____________________________________________________________
consensus CTTCCTGTGCTTCTATGTCACATTTGATTGCCCACTTCATCTGCATCAGATGATTATTTT
 
. : . : . : . : . : . :
rJMSF003L13+ GTTTGTTTTTGCCAATTCTTTATGCTTCTTGTTAAAGTTCGCATTTGTTTGTGTAAGAGA
rJMSF016C05+ GTTTGTTTTTGCCAATTCTTTATGCTTCTTGTTAAAGTTCGCATTTGTTTGTGTAAGAGA
                      ____________________________________________________________
consensus GTTTGTTTTTGCCAATTCTTTATGCTTCTTGTTAAAGTTCGCATTTGTTTGTGTAAGAGA
 
. : . : . : . : . : . :
rJMSF003L13+ GATGTTTTCTTTTCCCCCCTCTAATCTCCATACATAAATCTTCAGGAGAACCGCATTCA
rJMSF016C05+ GATGTTTTCTTTTCCCCCCTCTAATCTCCATACATAAATCTTCAGGAGAACCGCATTCAT
                      ____________________________________________________________
consensus GATGTTTTCTTTTCCCCCCTCTAATCTCCATACATAAATCTTCAGGAGAACCGCATTCAT