Previous Contig 011857:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF015P03Sequence481005583 (3)gb:AY250838_15927346e-56Arabidopsis thaliana 4-coumarate-CoA ligase-like protein (At1g20510) mRNA, compl742011857 (3)gb:AY250838_15927347e-93Arabidopsis thaliana 4-coumarate-CoA ligase-like protein (At1g20510) mRNA, compl
JMSF032I06Sequence685005583 (3)gb:AY250838_15927343e-78Arabidopsis thaliana 4-coumarate-CoA ligase-like protein (At1g20510) mRNA, compl718011857 (3)gb:AY250838_15927345e-82Arabidopsis thaliana 4-coumarate-CoA ligase-like protein (At1g20510) mRNA, compl
JMSF037J02Sequence683005583 (3)gb:AY250838_15927343e-78Arabidopsis thaliana 4-coumarate-CoA ligase-like protein (At1g20510) mRNA, compl696011857 (3)gb:AY250838_15927342e-85Arabidopsis thaliana 4-coumarate-CoA ligase-like protein (At1g20510) mRNA, compl

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF032I06+ TCG
rJMSF015P03+ GAGTCGACCGGAATTGGGGCGTCG
                      ____________________________________________________________
consensus GAGTCGACCGGAATTGGGGCGTCG
 
. : . : . : . : . : . :
rJMSF032I06+ ACTGACTCGTTGGAGGAGAGCCGGGAAGTACGGAACGGCGGGGGTTGTTGTCTCCGAGCA
rJMSF037J02+ GGAAGTACGGAACGGC-GGGGTTGTTGTCTCCGAGCA
rJMSF015P03+ ACTGACTCGTTGGAGGAGAGCC-GGAAGTACGGAACGGC-GGGGTTGTTGTCTCCGAGCA
                      ____________________________________________________________
consensus ACTGACTCGTTGGAGGAGAGCCGGGAAGTACGGAACGGC-GGGGTTGTTGTCTCCGAGCA
 
. : . : . : . : . : . :
rJMSF032I06+ TGGAGGCGAGAATTGTAGACCCCGATAGTGGGGAATTATTGCCGGTGAACCGCACCGGTG
rJMSF037J02+ TGGAGGCGAGAATTGTAGACCCCGATAGTGGGGAATTATTGCCGGTGAACCGCACCGGTG
rJMSF015P03+ TGGAGGCGAGAATTGTAGACCCCGATAGTGGGGAATTATTGCCGGTGAACCGCACCGGTG
                      ____________________________________________________________
consensus TGGAGGCGAGAATTGTAGACCCCGATAGTGGGGAATTATTGCCGGTGAACCGCACCGGTG
 
. : . : . : . : . : . :
rJMSF032I06+ AGCTGTGGCTCAGGGGACCCTGTATTATGAAAGGTTACTTCAGTAATGAAGAAGCTACGG
rJMSF037J02+ AGCTGTGGCTCAGGGGACCCTGTATTATGAAAGGTTACTTCAGTAATGAAGAAGCTACGG
rJMSF015P03+ AGCTGTGGCTCAGGGGACCCTGTATTATGAAAGGTTACTTCAGTAATGAAGAAGCTACGG
                      ____________________________________________________________
consensus AGCTGTGGCTCAGGGGACCCTGTATTATGAAAGGTTACTTCAGTAATGAAGAAGCTACGG
 
. : . : . : . : . : . :
rJMSF032I06+ CATCAACACTAGATTCAAACGGATGGTTAAGAACTGGGGATCTGTGTTACATTGATGATG
rJMSF037J02+ CATCAACACTAGATTCAAACGGATGGTTAAGAACTGGGGATCTGTGTTACATTGATGATG
rJMSF015P03+ CATCAACACTAGATTCAAACGGATGGTTAAGAACTGGGGATCTGTGTTACATTGATGATG
                      ____________________________________________________________
consensus CATCAACACTAGATTCAAACGGATGGTTAAGAACTGGGGATCTGTGTTACATTGATGATG
 
. : . : . : . : . : . :
rJMSF032I06+ ATGGATTTATATTTGTGGTTGATAGATTAAAGGAGCTGATTAAGTACAAGGGCTACCAGG
rJMSF037J02+ ATGGATTTATATTTGTGGTTGATAGATTAAAGGAGCTGATTAAGTACAAGGGCTACCAGG
rJMSF015P03+ ATGGATTTATATTTGTGGTTGATAGATTAAAGGAGCTGATTAAGTACAAGGGCTACCAGG
                      ____________________________________________________________
consensus ATGGATTTATATTTGTGGTTGATAGATTAAAGGAGCTGATTAAGTACAAGGGCTACCAGG
 
. : . : . : . : . : . :
rJMSF032I06+ TTCCTCCGGCAGAGTTGGAGGCTTTGTTGCTAACTCACCCTGAAGTTGCTGATGCTGCTG
rJMSF037J02+ TTCCTCCGGCAGAGTTGGAGGCTTTGTTGCTAACTCACCCTGAAGTTGCTGATGCTGCTG
rJMSF015P03+ TTCCTCCGGCAGAGTTGGAGGCTTTGTTGCTAACTCACCCTGAAGTTGCTGATGCTGCTG
                      ____________________________________________________________
consensus TTCCTCCGGCAGAGTTGGAGGCTTTGTTGCTAACTCACCCTGAAGTTGCTGATGCTGCTG
 
. : . : . : . : . : . :
rJMSF032I06+ TTATACCGTTTCCCGACAAGGATGTTGGACAGTTTCCAATGGTATATGTGGTGCGGAAAA
rJMSF037J02+ TTATACCGTTTCCCGACAAGGATGTTGGACAGTTTCCAATGGTATATTTGGTGCGGAAAA
rJMSF015P03+ TTATACCGTTTCCCGACAAGGATGTTGGACAGTTTCCAATGGTATATGTGGTGCGGAAAA
                      ____________________________________________________________
consensus TTATACCGTTTCCCGACAAGGATGTTGGACAGTTTCCAATGGTATATGTGGTGCGGAAAA
 
. : . : . : . : . : . :
rJMSF032I06+ CTGGAAGTAGTATCTCAGAAAATGCAGTCATGGATTTTGTTGGCAAGCAGGTGGCTCCAT
rJMSF037J02+ CTGGAAGTAGTATCTCAGAAAATGCAGTCATGGATTTTGTTGGCAAGCAGGTGGCTCCAT
rJMSF015P03+ CTGGAAGTAGTATCTCAGAAAATGCAGTCATGGATTTTGTTGGCAAGCAGGTGGCTCCAT
                      ____________________________________________________________
consensus CTGGAAGTAGTATCTCAGAAAATGCAGTCATGGATTTTGTTGGCAAGCAGGTGGCTCCAT
 
. : . : . : . : . : . :
rJMSF032I06+ ACAAGAGGATAAGGCGAGTGGCATTTGTAGCTTCCATCCCCAAGAATCCTTCAGGCAAGA
rJMSF037J02+ ACAAGAGGATAAGGCGAGTGGCATTTGTAGCTTCCATCCCCAAGAATCCTTCAGGCAAGA
rJMSF015P03+ ACAAGAGGATAAGGCGAGTGGCATTTGTAGCTTCCATCCCCAAGAATCCTTCAGGCAAGA
                      ____________________________________________________________
consensus ACAAGAGGATAAGGCGAGTGGCATTTGTAGCTTCCATCCCCAAGAATCCTTCAGGCAAGA
 
. : . : . : . : . : . :
rJMSF032I06+ TACTAAGGAAAGATTTAATAAAGCTCGCCACTTCTAAACTATGAGTCATTAAAGTTTTGC
rJMSF037J02+ TACTAAGGAAAGATTTAATAAAGCTCGCCACTTCTAAACTATGAGTCATTAAAGTTTTGC
rJMSF015P03+ TACTAAGGAAAGATTTAATAAAGCTCGCCACTTCTAAACTATGAGTCATTAAAGTTTTGC
                      ____________________________________________________________
consensus TACTAAGGAAAGATTTAATAAAGCTCGCCACTTCTAAACTATGAGTCATTAAAGTTTTGC
 
. : . : . : . : . : . :
rJMSF032I06+ CATATGCGTGGATTGGACATTTTTCTGTTATGTAATAATTTTGATATGTAAGCAATAAAT
rJMSF037J02+ CATATGCGTGGATTGGACATTTTTCTGTTATGTAATAATTTTGATATGTAAGCAATAAAT
rJMSF015P03+ CATATGCGTGGATTGGACATTTTTCTGTTATGTAATAATTTTGATATGTAAGCAATAAAT
                      ____________________________________________________________
consensus CATATGCGTGGATTGGACATTTTTCTGTTATGTAATAATTTTGATATGTAAGCAATAAAT
 
. : . : . : . : . : . :
rJMSF032I06+ NACAGTTTTAAGATTTCATCCTTTCTGTTGTTGTAAAGGCTACTAGTGATCTTT
rJMSF037J02+ TACAGTTTTAAGATTTCATCCTTTCTGTTGTTGTAAAGGCTACTAGTGATCTTT
rJMSF015P03+ TACAGTTTTAAGATTTCATCCTTTCTGTTGTTGTAAAGGCTACTAGTGATCTTTAAATAT
                      ____________________________________________________________
consensus TACAGTTTTAAGATTTCATCCTTTCTGTTGTTGTAAAGGCTACTAGTGATCTTTAAATAT