Previous Contig 011856:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF009F09Sequence454005070 (2)gb:MCY14797_16858992e-31Morinda citrifolia mRNA for 3-deoxy-D-arabino-heptulosonate 7-phosphate synthase795011856 (2)gb:AX027398_14570416e-90Sequence 9 from Patent WO0036124.>gb:ATHDHS2_1553148 A.thaliana 3-deoxy-D-arabin
JMSF015P02Sequence366005070 (2)gb:MCY14797_16858992e-15Morinda citrifolia mRNA for 3-deoxy-D-arabino-heptulosonate 7-phosphate synthase719011856 (2)gb:AY087659_15726883e-79Arabidopsis thaliana clone 37432 mRNA, complete sequence.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF009F09+ GCTCACATGCTTNGGTCGGGGAGCGCAC
                      ____________________________________________________________
consensus GCTCACATGCTTNGGTCGGGGAGCGCAC
 
. : . : . : . : . : . :
rJMSF009F09+ AAGGCAATGGACGGTGCACATGTTGAGTTCCTGAGAGGAGTTTCCAATCCACTCGGAATC
                      ____________________________________________________________
consensus AAGGCAATGGACGGTGCACATGTTGAGTTCCTGAGAGGAGTTTCCAATCCACTCGGAATC
 
. : . : . : . : . : . :
rJMSF009F09+ AAGGTGAGTCAGAAAATGGATCCGAGTGAGCTGGTCAGGCTTATAGATATTCTAAATCCT
rJMSF015P02+ AGGTGAGTCAGAAAATGGATCCGAGTGAGCTGGTCAGGCTTATAGATATTCTAAATCCT
                      ____________________________________________________________
consensus AAGGTGAGTCAGAAAATGGATCCGAGTGAGCTGGTCAGGCTTATAGATATTCTAAATCCT
 
. : . : . : . : . : . :
rJMSF009F09+ AAAAACAAACCAGGAAGAATAACGGTGATAGCCAGAATGGGAGCCGACAACATGAGAGTG
rJMSF015P02+ AAAAACAAACCAGGAAGAATAACGGTGATAGCCAGAATGGGAGCCGACAACATGAGAGTG
                      ____________________________________________________________
consensus AAAAACAAACCAGGAAGAATAACGGTGATAGCCAGAATGGGAGCCGACAACATGAGAGTG
 
. : . : . : . : . : . :
rJMSF009F09+ AAACTTCCCCATCTGATCAGGGCAGTTCGGAGTGCAGGTCAAATTGTTACTTGGGTCAGT
rJMSF015P02+ AAACTTCCCCATCTGATCAGGGCAGTTCGGAGTGCAGGTCAAATTGTTACTTGGGTCAGT
                      ____________________________________________________________
consensus AAACTTCCCCATCTGATCAGGGCAGTTCGGAGTGCAGGTCAAATTGTTACTTGGGTCAGT
 
. : . : . : . : . : . :
rJMSF009F09+ GATCCTATGCATGGGAATACCACTAAGGCTCCTTGTGGACTGAAAACCCGATCCTTCGAT
rJMSF015P02+ GATCCTATGCATGGGAATACCACTAAGGCTCCTTGTGGACTGAAAACCCGATCCTTCGAT
                      ____________________________________________________________
consensus GATCCTATGCATGGGAATACCACTAAGGCTCCTTGTGGACTGAAAACCCGATCCTTCGAT
 
. : . : . : . : . : . :
rJMSF009F09+ GCAATCAGGGCTGAGCTTAGAGCATTCTTTGATGTACACGACCAAGAAGGGAGCTTCCCG
rJMSF015P02+ GCAATCAGGGCTGAGCTTAGAGCATTCTTTGATGTACACGACCAAGAAGGGAGCTTCCCG
                      ____________________________________________________________
consensus GCAATCAGGGCTGAGCTTAGAGCATTCTTTGATGTACACGACCAAGAAGGGAGCTTCCCG
 
. : . : . : . : . : . :
rJMSF009F09+ GGGGGTGTGCATCTGGAGATGACTGGGCAGAACGTGACAGAGTGCGTTGGAGGGTCTCGC
rJMSF015P02+ GGGGGTGTGCATCTGGAGATGACTGGGCAGAACGTGACAGAGTGCGTTGGAGGGTCTCGC
                      ____________________________________________________________
consensus GGGGGTGTGCATCTGGAGATGACTGGGCAGAACGTGACAGAGTGCGTTGGAGGGTCTCGC
 
. : . : . : . : . : . :
rJMSF009F09+ ACAGTTACTTACAACGACCTAAGCTCGCGGTATCACACACACTGTGATCCAAGACTTAAT
rJMSF015P02+ ACAGTTACTTACAACGACCTAAGCTCGCGGTATCACACACACTGTGATCCAAGACTTAAT
                      ____________________________________________________________
consensus ACAGTTACTTACAACGACCTAAGCTCGCGGTATCACACACACTGTGATCCAAGACTTAAT
 
. : . : . : . : . : . :
rJMSF009F09+ GCTTCTCAGTCACTCGAGCTGGCCTTCAACATCGCAGAGCGCCTCCGAAGAAGGAGGCTT
rJMSF015P02+ GCTTCTCAGTCACTCGAGCTGGCCTTCAACATCGCAGAGCGCCTCCGAAGAAGGAGGCTT
                      ____________________________________________________________
consensus GCTTCTCAGTCACTCGAGCTGGCCTTCAACATCGCAGAGCGCCTCCGAAGAAGGAGGCTT
 
. : . : . : . : . : . :
rJMSF009F09+ GGATCTCTCTTCAAGCTCTGAAACCATTGGCCTTGCAGGGTCAGGTCTGGTTTTAGTTTG
rJMSF015P02+ GGATCTCTCTTCAAGCTCTGAAACCATTGGCCTTGCAGGGTCAGGTCTGGTTTTAGTTTG
                      ____________________________________________________________
consensus GGATCTCTCTTCAAGCTCTGAAACCATTGGCCTTGCAGGGTCAGGTCTGGTTTTAGTTTG
 
. : . : . : . : . : . :
rJMSF009F09+ GGTAAGAGAATCAAACACCTATTTCACCATCTACAGTGGATTACCGGTAATATAAGATGC
rJMSF015P02+ GGTAAGAGAATCAAACACCTATTTCACCATCTACAGTGGATTACCGGTAATATAAGATGC
                      ____________________________________________________________
consensus GGTAAGAGAATCAAACACCTATTTCACCATCTACAGTGGATTACCGGTAATATAAGATGC
 
. : . : . : . : . : . :
rJMSF009F09+ TATACAACTTAGAAGCTTTCTTGAATGTAAGCCTCAACTATAAAGTTAGGTTGCAGTTTT
rJMSF015P02+ TATACAACTTAGAAGCTTTCTTGAATGTAAGCCTCAACTATAAAGTTAGGTTGCAGTTTT
                      ____________________________________________________________
consensus TATACAACTTAGAAGCTTTCTTGAATGTAAGCCTCAACTATAAAGTTAGGTTGCAGTTTT
 
. : . : . : . : . : . :
rJMSF009F09+ GAAGTATGATGTTAGTAAGTACAGCAATAATCATCTGCTGACATAAC
rJMSF015P02+ GAAGTATGATGTTAGTAAGTACAGCAATAATCATCTGCTGACATAACTGGGTTTGCTAAA
                      ____________________________________________________________
consensus GAAGTATGATGTTAGTAAGTACAGCAATAATCATCTGCTGACATAACTGGGTTTGCTAAA