Previous Contig 011853:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF002G11Sequence571003458 (45)gb:AY050431_15622083e-12Arabidopsis thaliana AT4g26970/F10M23_310 mRNA, complete cds.>gb:BT000492_163477749011853 (12)gb:AP005505_18530312e-95Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC clone:P061
JMFF015F06Sequence569003458 (45)gb:AY050431_15622082e-11Arabidopsis thaliana AT4g26970/F10M23_310 mRNA, complete cds.>gb:BT000492_163477670011853 (12)gb:AP005505_18530311e-80Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC clone:P061
JMFF017O17Sequence470003458 (45)gb:AY050431_15622086e-13Arabidopsis thaliana AT4g26970/F10M23_310 mRNA, complete cds.>gb:BT000492_163477235011853 (12)
JMFF021O13Sequence551003458 (45)gb:AY050431_15622082e-10Arabidopsis thaliana AT4g26970/F10M23_310 mRNA, complete cds.>gb:BT000492_163477573011853 (12)gb:AP005505_18530314e-50Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC clone:P061
JMFF022B16Sequence473003458 (45)748011853 (12)gb:AP005505_18530316e-95Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC clone:P061
JMFF034I06Sequence348003458 (45)733011853 (12)gb:AP005505_18530312e-81Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC clone:P061
JMFS059F11Sequence624011853 (12)gb:AP005505_1853031e-110Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC clone:P061
JMFS119B10Sequence626011853 (12)gb:AP005505_18530314e-72Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC clone:P061
JMFS131A06Sequence613011853 (12)gb:AP005505_18530313e-95Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC clone:P061
JMSF015O06Sequence476003458 (45)gb:AY050431_15622086e-13Arabidopsis thaliana AT4g26970/F10M23_310 mRNA, complete cds.>gb:BT000492_163477784011853 (12)gb:AP005505_18530313e-93Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC clone:P061
JMSF042H16Sequence571003458 (45)gb:AY050431_15622089e-52Arabidopsis thaliana AT4g26970/F10M23_310 mRNA, complete cds.>gb:BT000492_163477553011853 (12)gb:AP005505_18530313e-88Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC clone:P061
JMSF043H08Sequence769003458 (45)gb:AY050431_15622083e-54Arabidopsis thaliana AT4g26970/F10M23_310 mRNA, complete cds.>gb:BT000492_163477754011853 (12)gb:AY136414_15819151e-80Arabidopsis thaliana cytoplasmic aconitate hydratase (At2g05710) mRNA, complete

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS059F11- AAGAAC
                      ____________________________________________________________
consensus AAGAAC
 
. : . : . : . : . : . :
JMFS059F11- CAATTGGGGTAGGCAAGGATGGTAAGGATGTCTATTTCAGGGATATCTGGCCAACAACAG
                      ____________________________________________________________
consensus CAATTGGGGTAGGCAAGGATGGTAAGGATGTCTATTTCAGGGATATCTGGCCAACAACAG
 
. : . : . : . : . : . :
JMFS059F11- AGGAAGTTGCTGAGGCTGTCCAATCCAGTGTGTTACCTGACATGTTCAAGAGTACATATG
                      ____________________________________________________________
consensus AGGAAGTTGCTGAGGCTGTCCAATCCAGTGTGTTACCTGACATGTTCAAGAGTACATATG
 
. : . : . : . : . : . :
JMFS059F11- AATCCATTACAAAGGGGAACCCGATGTGGAATCAGTTATCTGTCCCAGAAGCCAAGTTGT
                      ____________________________________________________________
consensus AATCCATTACAAAGGGGAACCCGATGTGGAATCAGTTATCTGTCCCAGAAGCCAAGTTGT
 
. : . : . : . : . : . :
JMFS059F11- ACTCGTGGGATCCTAATTCCACATACATTCATGAGCCACCATATTTCAAAGGCATGACTA
                      ____________________________________________________________
consensus ACTCGTGGGATCCTAATTCCACATACATTCATGAGCCACCATATTTCAAAGGCATGACTA
 
. : . : . : . : . : . :
JMFS059F11- TGGATCCTCCAGGAGCTCGTGGAGTGAAAGATGCGTATTGCTTATTGAACTTTGGTGATA
                      ____________________________________________________________
consensus TGGATCCTCCAGGAGCTCGTGGAGTGAAAGATGCGTATTGCTTATTGAACTTTGGTGATA
 
. : . : . : . : . : . :
JMFS059F11- GTATCACGACAGATCATATCTCTCCTGCTGGAAGCATTCACAAGGATAGTCCAGCTGCTA
                      ____________________________________________________________
consensus GTATCACGACAGATCATATCTCTCCTGCTGGAAGCATTCACAAGGATAGTCCAGCTGCTA
 
. : . : . : . : . : . :
JMFS059F11- AATACCTCCTTGAGCGAGGTGTTGACCGCAAGGACTTCAACTCTTATGGCAGTCGCCGTG
JMFS131A06- TATGGCAGTCGCCGTG
rJMFF002G11+ CTCTTATGGCAGTCGCCGTG
rJMFF022B16+ TATGGCAGTCGCCGTG
rJMSF042H16+ CCGTG
rJMSF015O06+ CGCCGTG
                      ____________________________________________________________
consensus AATACCTCCTTGAGCGAGGTGTTGACCGCAAGGACTTCAACTCTTATGGCAGTCGCCGTG
 
. : . : . : . : . : . :
JMFS059F11- GTAATGATGAAATCATGGCGA-GGGGTACATTTGCCAACATCCGCCTTGTAAACAAGCTG
JMFS131A06- GTAATGATGAAATCATGGCGA-GGGGTACATTTGCCAACATCCGCCTTGTAAACAAGCTG
rJMFF002G11+ GTAATGATGAAATCATGGCGA-GGGGTACATTTGCCAACATCCGCCTTGTAAACAAGCTG
rJMFF022B16+ GTAATGATGAAATCATGGCGA-GGGGTACATTTGCCAACATCCGCCTTGTAAACAAGCTG
rJMSF043H08+ GTACATTTGCCAACATCCGCCTTGTAAACAAGCTG
rJMSF042H16+ GTAATGATGAAATCATGGCGAGGGGGTACA-TTGCCAACATCCGCCTTGTAAACAAGCTG
rJMSF015O06+ GTAATGATGAAATCATGGCGA-GGGGTACATTTGCCAACATCCGCCTTGTAAACAAGCTG
                      ____________________________________________________________
consensus GTAATGATGAAATCATGGCGA-GGGGTACATTTGCCAACATCCGCCTTGTAAACAAGCTG
 
. : . : . : . : . : . :
JMFS059F11- CTAAGTGGAGAAGTTGGTCCAAAGACAGTTCACA-TTCCCACGGGAGAGAAACTCTATGT
rJMFF034I06+ CTAAGTGGAGAAGTTGGTCCAAAGACAGTTCACA-TTCCCACGGGAGAGAAACTCTATGT
JMFS131A06- CTAAGTGGAGAAGTTGGTCCAAAGACAGTTCACA-TTCCCACGGGAGAGAAACTCTATGT
rJMFF002G11+ CTAAGTGGAGAAGTTGGTCCAAAGACAGTTCACA-TTCCCACGGGAGAGAAACTCTATGT
rJMFF015F06+ AAGTGGAGAAGTTGGTCCAAAGACAGTTCACA-TTCCCACGGGAGAGAAACTCTATGT
rJMFF022B16+ CTAAGTGGAGAAGTTGGTCCAAAGACAGTTCACA-TTCCCACGGGAGAGAAACTCTATGT
rJMSF043H08+ CTAAGTGGAGAAGTTGGTCCAAAGACAGTTCACATTTCCCACGGGAGAGAAACTCTATGT
JMFS119B10- GAAACTCTATGT
rJMSF042H16+ CTAAGTGGAGAAGTTGGTCCAAAGACAGTTCACA-TTCCCACGGGAGAGAAACTCTATGT
rJMSF015O06+ CTAAGTGGAGAAGTTGGTCCAAAGACAGTTCACA-TTCCCACGGGAGAGAAACTCTATGT
                      ____________________________________________________________
consensus CTAAGTGGAGAAGTTGGTCCAAAGACAGTTCACA-TTCCCACGGGAGAGAAACTCTATGT
 
. : . : . : . : . : . :
JMFS059F11- GTTTGATGCTGCAATGAGATACAAGTCTGAAGGGAAGGACACTATAATCTTGGCTGGAGC
rJMFF034I06+ GTTTGATGCTGCAATGAGATACAAGTCTGAAGGGAAGGACACTATAATCTTGGCTGGAGC
JMFS131A06- GTTTGATGCTGCAATGAGATACAAGTCTGAAGGGAAGGACACTATAATCTTGGCTGGAGC
rJMFF002G11+ GTTTGATGCTGCAATGAGATACAAGTCTGAAGGGAAGGACACTATAATCTTGGCTGGAGC
rJMFF015F06+ GTTTGATGCTGCAATGAGATACAAGTCTGAAGGGAAGGACACTATAATCTTGGCTGGAGC
rJMFF022B16+ GTTTGATGCTGCAATGAGATACAAGTCTGAAGGGAAGGACACTATAATCTTGGCTGGAGC
rJMSF043H08+ GTTTGATGCTGCAATGAGATACAAGTCTGAAGGGAAGGACACTATAATCTTGGCTGGAGC
JMFS119B10- GTTTGATGCTGCAATGAGATACAAGTCTGAAGGGAAGGACACTATAATCTTGGCTGGAGC
rJMSF042H16+ GTTTGATGCTGCAATGAGATACAAGTCTGAAGGGAAGGACACTATAATCTTGGCTGGAGC
rJMSF015O06+ GTTTGATGCTGCAATGAGATACAAGTCTGAAGGGAAGGACACTATAATCTTGGCTGGAGC
                      ____________________________________________________________
consensus GTTTGATGCTGCAATGAGATACAAGTCTGAAGGGAAGGACACTATAATCTTGGCTGGAGC
 
. : . : . : . : . : . :
JMFS059F11- AGAATATGGAAGTGGTAGCT
rJMFF034I06+ AGAATATGGAAGTGGTAGCTCTAGGGATTGGGCTGCCAAGGGCCCAATGTTGTTGGGAGT
JMFS131A06- AGAATATGGAAGTGGTAGCTCTAGGGATTGGGCTGCCAAGGGCCCAATGTTGTTGGGAGT
rJMFF002G11+ AGAATATGGAAGTGGTAGCGCTAGGGATTGGGCTGCCAAGGGCCCAATGTTGTTGGGAGT
rJMFF015F06+ AGAATATGGAAGTGGTAGCGCTAGGGATTGGGCTGCCAAGGGCCCAATGTTGTTGGGAGT
rJMFF022B16+ AGAATATGGAAGTGGTAGCGCTAGGGATTGGGCTGCCAAGGGCCCAATGTTGTTGGGAGT
rJMSF043H08+ AGAATATGGAAGTGGTAGCTCTAGGGATTGGGCTGCCAAGGGCCCAATGTTGTTGGGAGT
rJMFF021O13+ GGGCCCAATGTTGTTGGGAGT
JMFS119B10- AGAATATGGAAGTGGTAGCTCTAGGGATTGGGCTGCCAAGGGCCCAATGTTGTTGGGAGT
rJMSF042H16+ AGAATATGGAAGTGGTAGCTCTAGGGATTGGGCTGCCAAGGGCCCAATGTTGTTGGGAGT
rJMSF015O06+ AGAATATGGAAGTGGTAGCTCTAGGGATTGGGCTGCCAAGGGCCCAATGTTGTTGGGAGT
                      ____________________________________________________________
consensus AGAATATGGAAGTGGTAGCTCTAGGGATTGGGCTGCCAAGGGCCCAATGTTGTTGGGAGT
 
. : . : . : . : . : . :
rJMFF034I06+ AAAAGCAGTTATAGCTAAAAGCTTTGAGAGGATTCACCGCAGCAACTTAGTTGGAATGGG
JMFS131A06- AAAAGCAGTTATAGCTAAAAGCTTTGAGATGATTCACCGCAGCAACTTAGTTGGAATGGG
rJMFF002G11+ AAAAGCAGTTATAGCTAAAAGCTTTGAGAGGATTCACCGCAGCAACTTAGTTGGAATGGG
rJMFF015F06+ AAAAGCAGTTATAGCTAAAAGCTTTGAGAGGATTCACCGCAGCAACTTAGTTGGAATGGG
rJMFF022B16+ AAAAGCAGTTATAGCTAAAAGCTTTGAGAGGATTCACCGCAGCAACTTAGTTGGAATGGG
rJMSF043H08+ AAAAGCAGTTATAGCTAAAAGCTTTGAGAGGATTCACCGCAGCAACTTAGTTGGAATGGG
rJMFF021O13+ AAAAGCAGTTATAGCTAAAAGCTTTGAGAGGATTCNCCGCAGCAACTTAGTTGGAATGGG
JMFS119B10- AAAAGCAGTTATAGCTAAAAGCTTTGAGAGGATTCACCGCAGCAACTTAGTTGGAATGGG
rJMSF042H16+ AAAAGCAGTTATAGCTAAAAGCTTTGAGAGGATTCACCGCAGCAACTTAGTTGGAATGGG
rJMSF015O06+ AAAAGCAGTTATAGCTAAAAGCTTTGAGAGGATTCACCGCAGCAACTTAGTTGGAATGGG
                      ____________________________________________________________
consensus AAAAGCAGTTATAGCTAAAAGCTTTGAGAGGATTCACCGCAGCAACTTAGTTGGAATGGG
 
. : . : . : . : . : . :
rJMFF034I06+ TATCGTTCCTCTGTGTTTCAAGGCCGGAGAGGATGCAGACTCACTTGGATTGACTGGCCA
JMFS131A06- TATCGTTCCTCTGTGTTTCAAGGCCGGAGAGGATGCAGACTCACTTGGATTGACTGGCCA
rJMFF002G11+ TATCGTTCCTCTGTGTTTCAAGGCCGGAGAGGATGCAGACTCACTTGGATTGACTGGCCA
rJMFF015F06+ TATCGTTCCTCTGTGTTTCAAGGCCGGAGAGGATGCAGACTCACTTGGATTGACTGGCCA
rJMFF022B16+ TATCGTTCCTCTGTGTTTCAAGGCCGGAGAGGATGCAGACTCACTTGGATTGACTGGCCA
rJMSF043H08+ TATCGTTCCTCTGTGTTTCAAGGCCGGAGAGGATGCAGACTCACTTGGATTGACTGGCCA
rJMFF021O13+ TATCGTTCCTCTGTGTTTCAAGGCCGGAGAGGATGCAGACTCACTTGGATTGACTGGCCA
JMFS119B10- TATCGTTCCTCTGTGTTTCAAGGCCGGAGAGGATGCAGACTCACTTGGATTGACTGGCCA
rJMSF042H16+ TATCGTTCCTCTGTGTTTCAAGGCCGGAGAGGATGCAGACTCACTTGGATTGACTGGCCA
rJMSF015O06+ TATCGTTCCTCTGTGTTTCAAGGCCGGAGAGGATGCAGACTCACTTGGATTGACTGGCCA
                      ____________________________________________________________
consensus TATCGTTCCTCTGTGTTTCAAGGCCGGAGAGGATGCAGACTCACTTGGATTGACTGGCCA
 
. : . : . : . : . : . :
rJMFF034I06+ CGAGCGCTACAGCATTGATCTTCCCAGCAATATTAATGAAATTCGCCCCGGTCAGGATGT
JMFS131A06- CGAGCGCTACAGCATTGATCTTCCCAGCAATATTAATGAAATTCGCCCCGGTCAGGATGT
rJMFF002G11+ CGAGCGCTACAGCATTGATCTTCCCAGCAATATTAATGAAATTCGCCCCGGTCAGGATGT
rJMFF015F06+ CGAGCGCTACAGCATTGATCTTCCCAGCAATATTAATGAAATTCGCCCCGGTCAGGATGT
rJMFF022B16+ CGAGCGCTACAGCATTGATCTTCCCAGCAATATTAATGAAATTCGCCCCGGTCAGGATGT
rJMSF043H08+ CGAGCGCTACAGCATTGATCTTCCCAGCAATATTAATGAAATTCGCCCCGGTCAGGATGT
rJMFF021O13+ CGAGCGNTACAGCATTGATCTTCCCAGCAATATTAATGAAATTCGCCCCGGTCAGGATGT
JMFS119B10- CGAGCGCTACAGCATTGATCTTCCCAGCAATATTAATGAAATTCGCCCCGGTCAGGATGT
rJMSF042H16+ CGAGCGCTACAGCATTGATCTTCCCAGCAATATTAATGAAATTCGCCCCGGTCAGGATGT
rJMSF015O06+ CGAGCGCTACAGCATTGATCTTCCCAGCAATATTAATGAAATTCGCCCCGGTCAGGATGT
                      ____________________________________________________________
consensus CGAGCGCTACAGCATTGATCTTCCCAGCAATATTAATGAAATTCGCCCCGGTCAGGATGT
 
. : . : . : . : . : . :
rJMFF034I06+ GACTGTTAAGACTGACAATGGAAAAACTTTCACTTGCACTGTACGCTTTGATACCGAGGT
JMFS131A06- GACTGTTAAGACTGACAATGGAAAAACTTTCACTTGCACTGTACGCTTTGATACCGAGGT
rJMFF002G11+ GACTGTTAAGACTGACAATGGAAAAACTTTCACTTGCACTGTACGCTTTGATACCGAGGT
rJMFF015F06+ GACTGTTAAGACTGACAATGGAAAAACTTTCACTTGCACTGTACGCTTTGATACCGAGGT
rJMFF022B16+ GACTGTTAAGACTGACAATGGAAAAACTTTCACTTGCACTGTACGCTTTGATACCGAGGT
rJMSF043H08+ GACTGTTAAGACTGACAATGGAAAAACTTTCACTTGCACTGTACGCTTTGATACCGAGGT
rJMFF021O13+ GACTGTTAAGACTGACAATGGAAAAACTTTCACTTGCACTGTACGCTTTGATACCGAGGT
JMFS119B10- GACTGTTAAGACTGACAATGGAAAAACTTTCACTTGCACTGTACGCTTTGATACCGAGGT
rJMSF042H16+ GACTGTTAAGACTGACAATGGAAAAACTTTCACTTGCACTGTACGCTTTGATACCGAGGT
rJMSF015O06+ GACTGTTAAGACTGACAATGGAAAAACTTTCACTTGCACTGTACGCTTTGATACCGAGGT
                      ____________________________________________________________
consensus GACTGTTAAGACTGACAATGGAAAAACTTTCACTTGCACTGTACGCTTTGATACCGAGGT
 
. : . : . : . : . : . :
rJMFF034I06+ GGAGTTGGCTTATTTCAATCATGGAGGCATTCTTCCATATGTTATTCGACAATTGTCCAA
JMFS131A06- GGAGTTGGCTTATTTCAATCATGGAGGCATTCTTCCATATGTTATTCGACAATTGTCCAA
rJMFF002G11+ GGAGTTGGCTTATTTCAATCATGGAGGCATTCTTCCATATGTTATTCGACAATTGTCCAA
rJMFF015F06+ GGAGTTGGCTTATTTCAATCATGGAGGCATTCTTCCATATGTTATTCGACAATTGTCCAA
rJMFF022B16+ GGAGTTGGCTTATTTCAATCATGGAGGCATTCTTCCATATGTTATTCGACAATTGTCCAA
rJMSF043H08+ GGAGTTGGCTTATTTCAATCATGGAGGCATTCTTCCATATGTTATTCGACAATTGTCCAA
rJMFF021O13+ GGAGTTGGCTTATTTCAATCATGGAGGCATTNTTCCATATGTTATTCGACAATTGTCCAA
JMFS119B10- GGAGTTGGCTTATTTCAATCATGGAGGCATTCTTCCATATGTTATTCGACAATTGTCCAA
rJMSF042H16+ GGAGTTGNNTTATTTCAATCATGGAGGCATTNTTCCATANGTTATTNGACAATNGTCCAA
rJMFF017O17+ GGAGGCATTNTTCCATATGTTNTTNGACAATTGTCCAA
rJMSF015O06+ GGAGTTGGCTTATTTCAATCATGGAGGCATTCTTCCATATGTTATTCGACAATTGTCCAA
                      ____________________________________________________________
consensus GGAGTTGGCTTATTTCAATCATGGAGGCATTCTTCCATATGTTATTCGACAATTGTCCAA
 
. : . : . : . : . : . :
rJMFF034I06+ GCAATGAGCAACT
JMFS131A06- GCAATGAGCAACTCAACTTTGCCGTCATGTGGTGGTGAAGCTTTTGGATTTCGG
rJMFF002G11+ GCAATGAGCAACTCAACTTTGCCGTCATGTGGTGGTGAAGCTTTTGGATTTCGGTGCTGT
rJMFF015F06+ GCAATGAGCAACTCAACTTTGCCGTCATGTGGTGGTGAAGCTTTTGGATTTCGGTGCTGT
rJMFF022B16+ GCAATGAGCAACTCAACTTTGCCGTCATGTGGTGGTGAAGCTTTTGGATTTCGGTGCTGT
rJMSF043H08+ GCAATGAGCAACTCAACTTTGCCGTCATGTGGTGGTGAAGCTTTTGGATTTCGGTGCTGT
rJMFF021O13+ GCAATGAGCAACT
JMFS119B10- GCAATGAGCAACTCAACTTTGCCGTCATGTGGTGGTGAAGCTTTTGGATTTCGGTGCTGT
rJMSF042H16+ GCAANGAGCA
rJMFF017O17+ GCAATGAGCAACTCAACNTTGCCGTCATGTGGTGGTGAAGCTTTTGGANNTCGGTGCTGT
rJMSF015O06+ GCAATGAGCAACTCAACTTTGCCGTCATGTGGTGGTGAAGCTTTTGGATTTCGGTGCTGT
                      ____________________________________________________________
consensus GCAATGAGCAACTCAACTTTGCCGTCATGTGGTGGTGAAGCTTTTGGATTTCGGTGCTGT
 
. : . : . : . : . : . :
rJMFF002G11+ AAAATTTGAAAGAAGAATAAAGAACAGAAAAAAGATTATTTCTGAAGAAACTTCAGGATG
rJMFF015F06+ AAAATTTGAAAGAAGAATAAAGAACAGAAAAAAGATTATTTCTGAAGAAACTTCAGGATG
rJMFF022B16+ AAAATTTGAAAGAAGAATAAAGAACAGAAAAAAGATTATTTCTGAAGAAACTTCAGGATG
rJMSF043H08+ AAAATTTGAAAGAAGAATAAAGAACAGAAAAAAGATTATTTCTGAAGAAACTTCAGGATG
JMFS119B10- AAAATTTGAAAGAAGAATAAAGAACAGAAAAAAGATTATTTCTGAAGAAACTTCAGGATG
rJMFF017O17+ AAAATTNGAAAGAAGAATAAAGNACAGNAAAAAGATTATTTCNGAAGAAANTTCAGGATG
rJMSF015O06+ AAAATTTGAAAGAAGAATAAAGAACAGAAAAAAGATTATTTCTGAAGAAACTTCAGGATG
                      ____________________________________________________________
consensus AAAATTTGAAAGAAGAATAAAGAACAGAAAAAAGATTATTTCTGAAGAAACTTCAGGATG
 
. : . : . : . : . : . :
rJMFF002G11+ GATGGTTGCAGTTTTTTTAAAGTAC-TGATCTTGTATTCTTTCCATACAGTGATCTGATC
rJMFF015F06+ GATGGTTGCAGTTTTTTTAAAGTAC-TGATCTTGTATTCTTTCCATACAGTGATCTGATC
rJMFF022B16+ GATGGTTGCAGTTTTTTTAAAGTAC-TGATCTTGTATTCTTTCCATACAGTGATCTGATC
rJMSF043H08+ GATGGTTGCAGTTTTTTTAAAGTAC-TGATCTTGTATTCTTTCCATACAGTGATCTGATC
JMFS119B10- GATGGTTGCAGTTTTTTTAAAGTAC-TGATCTTGTATTCTTTCCATACAGTGATCTGATC
rJMFF017O17+ GATGGAAGCAGTTTTTTTAAAGTACTTGATCTNGTATTCTTTCCATACAGTGATATGANC
rJMSF015O06+ GATGGTTGCAGTTTTTTTAAAGTAC-TGATCTTGTATTCTTTCCATACAGTGATCTGATC
                      ____________________________________________________________
consensus GATGGTTGCAGTTTTTTTAAAGTAC-TGATCTTGTATTCTTTCCATACAGTGATCTGATC
 
. : . : . : . : . : . :
rJMFF002G11+ GGATCGGAATAA
rJMFF015F06+ GGATCGGAATAACA
rJMFF022B16+ GGATCGGAATAACAT
rJMSF043H08+ GGATCGGAATAACATTAAATCTGTTACTGTACCTCTCAATGTTGGTAC
JMFS119B10- GGATCGGAATA
rJMFF017O17+ GGATNGGAATAACATTA
rJMSF015O06+ GGATCGGAATAACATTAAATCTGTTACTGTACCTCTCAATGTTGGTACCCCCGGCATTGG
                      ____________________________________________________________
consensus GGATCGGAATAACATTAAATCTGTTACTGTACCTCTCAATGTTGGTACCCCCGGCATTGG