Previous Contig 011851:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF015N22Sequence499007200 (3)gb:AY061648_15648993e-15Nicotiana tabacum bZIP transcription factor (BZI-1) mRNA, complete cds.789011851 (3)gb:AY061648_15648992e-59Nicotiana tabacum bZIP transcription factor (BZI-1) mRNA, complete cds.
JMSF038C16Sequence640007200 (3)gb:AY061648_15648990.001Nicotiana tabacum bZIP transcription factor (BZI-1) mRNA, complete cds.867011851 (3)gb:AY061648_15648991e-57Nicotiana tabacum bZIP transcription factor (BZI-1) mRNA, complete cds.
JMSF050K23Sequence680020539pir|A86224|A862242e-65hypothetical protein [imported] - Arabidopsis thaliana>gb:AE005172_889920 Arabid774011851 (3)gb:AY061648_15648993e-58Nicotiana tabacum bZIP transcription factor (BZI-1) mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF038C16+ ATTGCATGGATCCTCAAGATT
                      ____________________________________________________________
consensus ATTGCATGGATCCTCAAGATT
 
. : . : . : . : . : . :
rJMSF038C16+ CAGCCACCATGTTGCCTGACAAAGGATTAGAGGCATCCATTTCCAACCCAGGATCTGTGG
                      ____________________________________________________________
consensus CAGCCACCATGTTGCCTGACAAAGGATTAGAGGCATCCATTTCCAACCCAGGATCTGTGG
 
. : . : . : . : . : . :
rJMSF038C16+ TCCCTCCTAAAGGATCTGGGAATGATTTTCCCAAGGGGGATGCTGAAGGGCCTGCTGGAA
                      ____________________________________________________________
consensus TCCCTCCTAAAGGATCTGGGAATGATTTTCCCAAGGGGGATGCTGAAGGGCCTGCTGGAA
 
. : . : . : . : . : . :
rJMSF038C16+ CATCTACCTTACCTGCAGTGCAGAAGAAATCTAGTGCCAGGGCACAGTCAGCAAGTGGCT
                      ____________________________________________________________
consensus CATCTACCTTACCTGCAGTGCAGAAGAAATCTAGTGCCAGGGCACAGTCAGCAAGTGGCT
 
. : . : . : . : . : . :
rJMSF038C16+ CAGAACCGTCTGATGATGATGAAGCTGAAGGGGAAGCAGAAACAACTCACCGAACTGATG
                      ____________________________________________________________
consensus CAGAACCGTCTGATGATGATGAAGCTGAAGGGGAAGCAGAAACAACTCACCGAACTGATG
 
. : . : . : . : . : . :
rJMSF038C16+ CAAAACGTGTAAGGAGAGAATCAGCTAGACGTTCTAGAAGAAGAAAGCAGGTCCATCTGA
rJMSF050K23+ AGAGAATCAGCTAGACGTTCTAGAAGAAGAAAGCAGGTCCATCTGA
rJMSF015N22+ AGAGAATCAGCTAGACGTTCTAGAAGAAGAAAGCAGGTCCATCTGA
                      ____________________________________________________________
consensus CAAAACGTGTAAGGAGAGAATCAGCTAGACGTTCTAGAAGAAGAAAGCAGGTCCATCTGA
 
. : . : . : . : . : . :
rJMSF038C16+ CGGACTTGGAGACACAGGTTTCTCAATTGAAAGTTGAAAACTCCTCTTTATTGAAGCGTT
rJMSF050K23+ CGGACTTGGAGACACAGGTTTCTCAATTGAAAGTTGAAAACTCCTCTTTATTGAAGCGTT
rJMSF015N22+ CGGACTTGGAGACACAGGTTTCTCAATTGAAAGTTGAAAACTCCTCTTTATTGAAGCGTT
                      ____________________________________________________________
consensus CGGACTTGGAGACACAGGTTTCTCAATTGAAAGTTGAAAACTCCTCTTTATTGAAGCGTT
 
. : . : . : . : . : . :
rJMSF038C16+ GGACTGAAGTAAGCCAAAAACATAACGACGCAGCAGTTGACAATAGAATCTTGAAAGCGG
rJMSF050K23+ GGACTGAAGTAAGCCAAAAACATAACGACGCAGCAGTTGACAATAGAATCTTGAAAGCGG
rJMSF015N22+ GGACTGAAGTAAGCCAAAAACATAGCGACGCAGCAGTTGACAATAGAATCTTGAAAGCGG
                      ____________________________________________________________
consensus GGACTGAAGTAAGCCAAAAACATAACGACGCAGCAGTTGACAATAGAATCTTGAAAGCGG
 
. : . : . : . : . : . :
rJMSF038C16+ ATGTTGAGACACTAAGAGCAAAGGTGAAGATGGCTGAGGAAACAGTTAAAAGAATTACTG
rJMSF050K23+ ATGTTGAGACACTAAGAGCAAAGGTGAAGATGGCTGAGGAAACAGTTAAAAGAATTACTG
rJMSF015N22+ ATGTTGAGACACTAAGAGCAAAGGTGAAGATGGCTGAGGAAACAGTTAAAAGAATTACTG
                      ____________________________________________________________
consensus ATGTTGAGACACTAAGAGCAAAGGTGAAGATGGCTGAGGAAACAGTTAAAAGAATTACTG
 
. : . : . : . : . : . :
rJMSF038C16+ GGATGCATTCACTATTCCAAACTATGCCCGAGATACCCACATTGAGCATACCATCCTTCG
rJMSF050K23+ GGATGCATTCACTATTCCAAACTATGCCCGAGATACCCACATTGAGCATACCATCCTTCG
rJMSF015N22+ GGATGCATTCACTATTCCAAACTATGCCCGAGATACCCACATTGAGCATACCATCCTTCG
                      ____________________________________________________________
consensus GGATGCATTCACTATTCCAAACTATGCCCGAGATACCCACATTGAGCATACCATCCTTCG
 
. : . : . : . : . : . :
rJMSF038C16+ TTGATAGCCATTCCGACACATCAGCCGATGCTACTGTACCGCTGCAAGAAGATGCTGATA
rJMSF050K23+ TTGATAGCCATTCCGACACATCAGCCGATGCTACTGTACCGCTGCAAGAAGATGCTGATA
rJMSF015N22+ TTGATAGCCATTCCGACACATCAGCCGATGCTACTGTACCGCTGCAAGAAGATGCTGATA
                      ____________________________________________________________
consensus TTGATAGCCATTCCGACACATCAGCCGATGCTACTGTACCGCTGCAAGAAGATGCTGATA
 
. : . : . : . : . : . :
rJMSF038C16+ ACCACTACTACCAATCCCTTTGCCATGATTCTAGTATCCAGAATGGCTTGCTGGACATCC
rJMSF050K23+ ACCACTACTACCAATCCCTTTGCCATGATTCTAGTATCCAGAATGGCTTGCTGGACATCC
rJMSF015N22+ ACCACTACTACCAATCCCTTTGCCATGATTCTAGTATCCAGAATGGCTTGCTGGACATCC
                      ____________________________________________________________
consensus ACCACTACTACCAATCCCTTTGCCATGATTCTAGTATCCAGAATGGCTTGCTGGACATCC
 
. : . : . : . : . : . :
rJMSF038C16+ CTCCGGTTGATAACGCACGACAGGATTCTGCTGCAACAGCAGGGGTGAACAATATCGGAG
rJMSF050K23+ CTCCGGTTGATAACGCACGACAGGATTCTGCTGCAACAGCAGGGGTGAACAATATCGGAG
rJMSF015N22+ CTCCGGTTGATAACGCACGACAGGATTCTGCTGCAACAGCAGGGGTGAACAATATCGGAG
                      ____________________________________________________________
consensus CTCCGGTTGATAACGCACGACAGGATTCTGCTGCAACAGCAGGGGTGAACAATATCGGAG
 
. : . : . : . : . : . :
rJMSF038C16+ GGATGGCTTCAATGCTGAGAGTGGCCAGCTTGGAAAACCTGCAGAATCGCATCCGCAGAG
rJMSF050K23+ GGATGGCTTCAATGCTGAGAGTGGCCAGCTTGGAAAACCTGCAGAATCGCATCCGCAGAG
rJMSF015N22+ GGATGGCTTCAATGCTGAGAGTGGCCAGCTTGGAAAACCTGCAGAATCGCATCCGCAGAG
                      ____________________________________________________________
consensus GGATGGCTTCAATGCTGAGAGTGGCCAGCTTGGAAAACCTGCAGAATCGCATCCGCAGAG
 
. : . : . : . : . : . :
rJMSF038C16+ AAGCAGGAGGTTCATGTAGAACTCAGTGCAGGATAAGCAAATGATGTGCATAAAGGGACC
rJMSF050K23+ AAGCAGGAGGTTCATGTAGAACTCAGTGCAGGATAAGCAAATGATGTGCATAAAGGGACC
rJMSF015N22+ AAGCAGGAGGTTCATGTAGAACTCAGTGCAGGATAAGCAAATGATGTGCATAAAGGGACC
                      ____________________________________________________________
consensus AAGCAGGAGGTTCATGTAGAACTCAGTGCAGGATAAGCAAATGATGTGCATAAAGGGACC
 
. : . : . : . : . : . :
rJMSF050K23+ TA--ATAAATCTAAACTTTGTGCTAAATCCACCAAAAAACTATTTTGTGCCATGGTTCAT
rJMSF015N22+ TAATATAAATCTAAACTTTGTGCTAAATCCACCAAAAAACTATTTTGTGCCATGGTTCAT
                      ____________________________________________________________
consensus TAATATAAATCTAAACTTTGTGCTAAATCCACCAAAAAACTATTTTGTGCCATGGTTCAT
 
. : . : . : . : . : . :
rJMSF050K23+ GCTAGAAAATGGTTTTGTTTTCAGTGATGGAATGATTCATTTTGCGTGAA
rJMSF015N22+ GCTAGAAAATGGTTTTGTTTTCAGTGATGGAATGATTCATTTTGCGTGAATTCACTGGAT
                      ____________________________________________________________
consensus GCTAGAAAATGGTTTTGTTTTCAGTGATGGAATGATTCATTTTGCGTGAATTCACTGGAT