Previous Contig 011850:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF010H18Sequence578000547 (2)pir|C84425|C844252e-43similar to axi 1 protein from Nicotiana tabacum [imported] - Arabidopsis thalian729011850 (3)pir|C84425|C844254e-27similar to axi 1 protein from Nicotiana tabacum [imported] - Arabidopsis thalian
JMSF015M22Sequence450000547 (2)pir|C84425|C844252e-22similar to axi 1 protein from Nicotiana tabacum [imported] - Arabidopsis thalian741011850 (3)pir|C84425|C844252e-28similar to axi 1 protein from Nicotiana tabacum [imported] - Arabidopsis thalian
JMSF046J22Sequence741020356pir|C84425|C84425e-114similar to axi 1 protein from Nicotiana tabacum [imported] - Arabidopsis thalian768011850 (3)pir|C84425|C844253e-36similar to axi 1 protein from Nicotiana tabacum [imported] - Arabidopsis thalian

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF046J22+ CAAGGAGGGGAATTTCCCACATTTTC
                      ____________________________________________________________
consensus CAAGGAGGGGAATTTCCCACATTTTC
 
. : . : . : . : . : . :
rJMSF046J22+ TACTAGGACACAGAAGATACTTGTATGGTGGGGCACTCTAGGACAATCCGGCCGGACAAG
rJMFF010H18+ CCGGACAAG
rJMSF015M22+ AGGACAATCCGGCCGGACAAG
                      ____________________________________________________________
consensus TACTAGGACACAGAAGATACTTGTATGGTGGGGCACTCTAGGACAATCCGGCCGGACAAG
 
. : . : . : . : . : . :
rJMSF046J22+ AGGAAACTTGCACTATTATTTGATAATCCAAATATTGGGTGGAAGAGCTTCAAGCGCCAA
rJMFF010H18+ AGGAAACTTGCACTATTATTTGATAATCCAAATATTGGGTGGAAGAGCTTCAAGCGCCAA
rJMSF015M22+ AGGAAACTTGCACTATTATTTGATAATCCAAATATTGGGTGGAAGAGCTTCAAGCGCCAA
                      ____________________________________________________________
consensus AGGAAACTTGCACTATTATTTGATAATCCAAATATTGGGTGGAAGAGCTTCAAGCGCCAA
 
. : . : . : . : . : . :
rJMSF046J22+ ATGCTAAATATGCGAGCGCATAGTGATTCGAAAGGGATTGAGCTGAAAAGGCCCAATGAT
rJMFF010H18+ ATGCTAAATATGCGAGCGCATAGTGATTCGAAAGGGATTGAGCTGAAAAGGCCCAATGAT
rJMSF015M22+ ATGCTAAATATGCGAGCGCATAGTGATTCGAAAGGGATTGAGCTGAAAAGGCCCAATGAT
                      ____________________________________________________________
consensus ATGCTAAATATGCGAGCGCATAGTGATTCGAAAGGGATTGAGCTGAAAAGGCCCAATGAT
 
. : . : . : . : . : . :
rJMSF046J22+ TCTATATACTCCTTCCCTTGTCCAGACTGCATGTGCCGCCTTAATAAAACAAAAGATTCA
rJMFF010H18+ TCTATATACTCCTTCCCTTGTCCAGACTGCATGTGCCGCCTTAATAAAACAAAAGATTCA
rJMSF015M22+ TCTATATACTCCTTCCCTTGTCCAGACTGCATGTGCCGCCTTAATAAAACAAAAGATTCA
                      ____________________________________________________________
consensus TCTATATACTCCTTCCCTTGTCCAGACTGCATGTGCCGCCTTAATAAAACAAAAGATTCA
 
. : . : . : . : . : . :
rJMSF046J22+ AAATTGTCGCCTGGGACGTGATCCCTGAAATGAAGGTTGTGTTTTTTGTTCCTGTAATTT
rJMFF010H18+ AAATTGTCGCCTGGGACGTGATCCCTGAAATGAAGGTTGTGTTTTTTGTTCCTGTAATTT
rJMSF015M22+ AAATTGTCGCCTGGGACGTGATCCCTGAAATGAAGGTTGTGTTTTTTGTTCCTGTAATTT
                      ____________________________________________________________
consensus AAATTGTCGCCTGGGACGTGATCCCTGAAATGAAGGTTGTGTTTTTTGTTCCTGTAATTT
 
. : . : . : . : . : . :
rJMSF046J22+ GTGTGAACATCTAGTTGCTAACCCCAGTGATTCTTTCATTTTTTACCCTCTTTCTATTGG
rJMFF010H18+ GTGTGAACATCTAGTTGCTAACCCCAGTGATTCTTTCATTTTTTACCCTCTTTCTATTGG
rJMSF015M22+ GTGTGAACATCTAGTTGCTAACCCCAGTGATTCTTTCATTTTTTACCCTCTTTCTATTGG
                      ____________________________________________________________
consensus GTGTGAACATCTAGTTGCTAACCCCAGTGATTCTTTCATTTTTTACCCTCTTTCTATTGG
 
. : . : . : . : . : . :
rJMSF046J22+ AGAGAGGTCAACTACTTGGATTTTGAAAGGCTTGCGTTCCTCCTCCGGGGTCGAATATGA
rJMFF010H18+ AGAGAGGTCAACTACTTGGATTTTGAAAGGCTTGCGTTCCTCCTCCGGGGTCGAATATGA
rJMSF015M22+ AGAGAGGTCAACTACTTGGATTTTGAAAGGCTTGCGTTCCTCCTCCGGGGTCGAATATGA
                      ____________________________________________________________
consensus AGAGAGGTCAACTACTTGGATTTTGAAAGGCTTGCGTTCCTCCTCCGGGGTCGAATATGA
 
. : . : . : . : . : . :
rJMSF046J22+ TATTTTACGGGGCATGTCTCGATGGGTAACTGCTCTTCAAAGATGACGGAATTGAAGACG
rJMFF010H18+ TATTTTACGGGGCATGTCTCGATGGGTAACTGCTCTTCAAAGATGACGGAATTGAAGACG
rJMSF015M22+ TATTTTACGGGGCATGTCTCGATGGGTAACTGCTCTTCAAAGATGACGGAATTGAAGACG
                      ____________________________________________________________
consensus TATTTTACGGGGCATGTCTCGATGGGTAACTGCTCTTCAAAGATGACGGAATTGAAGACG
 
. : . : . : . : . : . :
rJMSF046J22+ ATTTTCCAGTCCATAGTTACCCAGGTGTTGATAAATTTCACTTTATCTGACCAAGCTGAA
rJMFF010H18+ ATTTTCCAGTCCATAGTTACCCAGGTGTTGATAAATTTCACTTTATCTGACCAAGCTGAA
rJMSF015M22+ ATTTTCCAGTCCATAGTTACCCAGGTGTTGATAAATTTCACTTTATCTGACCAAGCTGAA
                      ____________________________________________________________
consensus ATTTTCCAGTCCATAGTTACCCAGGTGTTGATAAATTTCACTTTATCTGACCAAGCTGAA
 
. : . : . : . : . : . :
rJMSF046J22+ AATTGACAACAGAACATACATTTTCCAGTTTCCACATTGGTTTTGCTGTAATTGTATTTT
rJMFF010H18+ AATTGACAACAGAACATACATTTTCCAGTTTCCACATTGGTTTTGCTGTAATTGTATTTT
rJMSF015M22+ AATTGACAACAGAACATACATTTTCCAGTTTCCACATTGGTTTTGCTGTAATTGTATTTT
                      ____________________________________________________________
consensus AATTGACAACAGAACATACATTTTCCAGTTTCCACATTGGTTTTGCTGTAATTGTATTTT
 
. : . : . : . : . : . :
rJMSF046J22+ TGTACGTTTCTTGTTCAGTAGTATGTTAGACCATAGAAGAATGACGATGAAGAACAGTAT
rJMFF010H18+ TGTACGTTTCTTGTTCAGTAGTATGTTAGACCATAGAAGAATGACGATGAAGAACAGTAT
rJMSF015M22+ TGTACGTTTCTTGTTCAGTAGTATGTTAGACCATAGAAGAATGACGATGAAGAACAGTAT
                      ____________________________________________________________
consensus TGTACGTTTCTTGTTCAGTAGTATGTTAGACCATAGAAGAATGACGATGAAGAACAGTAT
 
. : . : . : . : . : . :
rJMSF046J22+ AGGATTTTGAAAATGCTTGGGTTCCAAATTTTTATTTTTGGATACCCACCCTACCCTACC
rJMFF010H18+ AGGATTTTGAAAATGCTTGGGTTCCAAATTTTTATTTTTGGATACCCACCCTACCCTACC
rJMSF015M22+ AGGATTTTGAAAATGCTTGGGTTCCAAATTTTTATTTTTGGATACCCACCCTACCCTACC
                      ____________________________________________________________
consensus AGGATTTTGAAAATGCTTGGGTTCCAAATTTTTATTTTTGGATACCCACCCTACCCTACC
 
. : . : . : . : . : . :
rJMSF046J22+ CTACCCTTTATGTGAAATTTAT
rJMFF010H18+ CTACCCTTTATGTGAAATTTATATTCCCAGAGGTTCCAACCTCCGGGACCAGGAT
rJMSF015M22+ CTACCCTTTATGTGAAATTTATATTCCCAGAGGTTCCAACCTCCGGGACCAGGATTGTTG
                      ____________________________________________________________
consensus CTACCCTTTATGTGAAATTTATATTCCCAGAGGTTCCAACCTCCGGGACCAGGATTGTTG