Previous Contig 011848:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF015M19Sequence463005578 (4)712011848 (4)gb:BT004983_16379296e-28Arabidopsis thaliana clone U50567 unknown protein (At1g79020) mRNA, complete cds
JMSF031G21Sequence648005578 (4)724011848 (4)gb:BT004983_16379292e-13Arabidopsis thaliana clone U50567 unknown protein (At1g79020) mRNA, complete cds
JMSF033C13Sequence671005578 (4)772011848 (4)gb:BT004983_16379293e-13Arabidopsis thaliana clone U50567 unknown protein (At1g79020) mRNA, complete cds
JMSF035O23Sequence671005578 (4)612011848 (4)gb:BT004983_16379292e-13Arabidopsis thaliana clone U50567 unknown protein (At1g79020) mRNA, complete cds

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF033C13+ GTGCATGGACATTTTTTTCGCCTTTTGGT
                      ____________________________________________________________
consensus GTGCATGGACATTTTTTTCGCCTTTTGGT
 
. : . : . : . : . : . :
rJMSF033C13+ TTTACTTAANCAAGGGAATGTGGATGCATATAATCATATGTATGTATGTGCATATATACA
                      ____________________________________________________________
consensus TTTACTTAANCAAGGGAATGTGGATGCATATAATCATATGTATGTATGTGCATATATACA
 
. : . : . : . : . : . :
rJMSF033C13+ TATTTATGTATGTATGTGCATATAGGTAACTAGATGTTGAATAGGGATATGAAATTAAGG
                      ____________________________________________________________
consensus TATTTATGTATGTATGTGCATATAGGTAACTAGATGTTGAATAGGGATATGAAATTAAGG
 
. : . : . : . : . : . :
rJMSF033C13+ TTTCTTCATTTCTGACATAGGTGCACTGTGTTAGAGAAACACATTATGGAACTACCATTT
                      ____________________________________________________________
consensus TTTCTTCATTTCTGACATAGGTGCACTGTGTTAGAGAAACACATTATGGAACTACCATTT
 
. : . : . : . : . : . :
rJMSF033C13+ CTTATAACATGGTAAATGCAGGATCCTAATGAGCCAATTCTGCTGTTCACAAAACCTCTG
rJMSF035O23+ GGATCCTAATGAGCCAATTCTGCTGTTCACAAAACCTCTG
rJMSF031G21+ GGATCCTAATGAGCCAATTCTGCTGTTCACAAAACCTCTG
rJMSF015M19+ GGATCCTAATGAGCCAATTCTGCTGTTCACAAAACCTCTG
                      ____________________________________________________________
consensus CTTATAACATGGTAAATGCAGGATCCTAATGAGCCAATTCTGCTGTTCACAAAACCTCTG
 
. : . : . : . : . : . :
rJMSF033C13+ GATCCCGAGAAACTGGCAGCTGCAGGCATTATGCCACCAACAGATTCATCAATGGCCAAT
rJMSF035O23+ GATCCCGAGAAACTGGCAGCTGCAGGCATTATGCCACCAACAGATTCATCAATGGCCAAT
rJMSF031G21+ GATCCCGAGAAACTGGCAGCTGCAGGCATTATGCCACCAACAGATTCATCAATGGCCAAT
rJMSF015M19+ GATCCCGAGAAACTGGCAGCTGCAGGCATTATGCCACCAACAGATTCATCAATGGCCAAT
                      ____________________________________________________________
consensus GATCCCGAGAAACTGGCAGCTGCAGGCATTATGCCACCAACAGATTCATCAATGGCCAAT
 
. : . : . : . : . : . :
rJMSF033C13+ GTCATATCAGGGCGCCCATTTAATTTCCGTGGACGAATAGGCAGGGGTGGCCGACTGGTG
rJMSF035O23+ GTCATATCAGGGCGCCCATTTAATTTCCGTGGACGAATAGGCAGGGGTGGCCGACTGGTG
rJMSF031G21+ GTCATATCAGGGCGCCCATTTAATTTCCGTGGACGAATAGGCAGGGGTGGCCGACTGGTG
rJMSF015M19+ GTCATATCAGGGCGCCCATTTAATTTCCGTGGACGAATAGGCAGGGGTGGCCGACTGGTG
                      ____________________________________________________________
consensus GTCATATCAGGGCGCCCATTTAATTTCCGTGGACGAATAGGCAGGGGTGGCCGACTGGTG
 
. : . : . : . : . : . :
rJMSF033C13+ TTTGACAGATGGAATCCACTTATGCATACTCCAATTGAGTGCGGTGATACTTTATACCTA
rJMSF035O23+ TTTGACAGATGGAATCCACTTATGCATACTCCAATTGAGTGCGGTGATACTTTATACCTA
rJMSF031G21+ TTTGACAGATGGAATCCACTTATGCATACTCCAATTGAGTGCGGTGATACTTTATACCTA
rJMSF015M19+ TTTGACAGATGGAATCCACTTATGCATACTCCAATTGAGTGCGGTGATACTTTATACCTA
                      ____________________________________________________________
consensus TTTGACAGATGGAATCCACTTATGCATACTCCAATTGAGTGCGGTGATACTTTATACCTA
 
. : . : . : . : . : . :
rJMSF033C13+ CCACCAAAGCCCCGGCCAGCCACCCATCGCTGATATGAAATGTTATTTCCAGTTTCTGAA
rJMSF035O23+ CCACCAAAGCCCCGGCCAGCCACCCATCGCTGATATGAAATGTTATTTCCAGTTTCTGAA
rJMSF031G21+ CCACCAAAGCCCCGGCCAGCCACCCATCGCTGATATGAAATGTTATTTCCAGTTTCTGAA
rJMSF015M19+ CCACCAAAGCCCCGGCCAGCCACCCATCGCTGATATGAAATGTTATTTCCAGTTTCTGAA
                      ____________________________________________________________
consensus CCACCAAAGCCCCGGCCAGCCACCCATCGCTGATATGAAATGTTATTTCCAGTTTCTGAA
 
. : . : . : . : . : . :
rJMSF033C13+ CTTGGAAGAGTATGCTCTATGGTTCTATGCTCTAGGTTTACCATAGCTCATTGTGCAATT
rJMSF035O23+ CTTGGAAGAGTATGCTCTATGGTTCTATGCTCTAGGTTTACCATAGCTCATTGTGCAATT
rJMSF031G21+ CTTGGAAGAGTATGCTCTATGGTTCTATGCTCTAGGTTTACCATAGCTCATTGTGCAATT
rJMSF015M19+ CTTGGAAGAGTATGCTCTATGGTTCTATGCTCTAGGTTTACCATAGCTCATTGTGCAATT
                      ____________________________________________________________
consensus CTTGGAAGAGTATGCTCTATGGTTCTATGCTCTAGGTTTACCATAGCTCATTGTGCAATT
 
. : . : . : . : . : . :
rJMSF033C13+ AACATTGTATTCTTCAAGGTTAGGAAAAAGAGCACACCCTTTGTACAATTAGCGGTATTC
rJMSF035O23+ AACATTGTATTCTTCAAGGTTAGGAAAAAGAGCACACCCTTTGTACAATTAGCGGTATTC
rJMSF031G21+ AACATTGTATTCTTCAAGGTTAGGAAAAAGAGCACACCCTTTGTACAATTAGCGGTATTC
rJMSF015M19+ AACATTGTATTCTTCAAGGTTAGGAAAAAGAGCACACCCTTTGTACAATTAGCGGTATTC
                      ____________________________________________________________
consensus AACATTGTATTCTTCAAGGTTAGGAAAAAGAGCACACCCTTTGTACAATTAGCGGTATTC
 
. : . : . : . : . : . :
rJMSF033C13+ TCGTGTTTTTTTCGAGGCTAGTCGGTAGAAAGGAAGAGCCCAACAGAGCGTCTTTGTTGC
rJMSF035O23+ TCGTGTTTTTTTCGAGGCTAGTCGGTAGAAAGGAAGAGCCCAACAGAGCGTCTTTGTTGC
rJMSF031G21+ TCGTGTTTTTTTCGAGGCTGGTCGGTAGAAAGGAAGAGCCCAACAGAGCGTCTTTGTTGC
rJMSF015M19+ TCGTGTTTTTTTCGAGGCTAGTCGGTAGAAAGGAAGAGCCCAACAGAGCGTCTTTGTTGC
                      ____________________________________________________________
consensus TCGTGTTTTTTTCGAGGCTAGTCGGTAGAAAGGAAGAGCCCAACAGAGCGTCTTTGTTGC
 
. : . : . : . : . : . :
rJMSF033C13+ GGATTTAGCAACATGATG
rJMSF035O23+ GGATTTAGCAACATGATG
rJMSF031G21+ GGATTTAGCAACATGATG
rJMSF015M19+ GGATTTAGCAACATGATGTTTGGAGTAAATGCGTAGATAGTGTTTTAAATGAAATGGAAT
                      ____________________________________________________________
consensus GGATTTAGCAACATGATGTTTGGAGTAAATGCGTAGATAGTGTTTTAAATGAAATGGAAT