Previous Contig 011843:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF001L22Sequence289004350 (2)gb:AK117805_18158181e-18Arabidopsis thaliana At1g79690 mRNA for unknown protein, complete cds, clone: RA739011843 (3)gb:AP004054_18370133e-50Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ12
JMSF013F05Sequence587005393 (2)716011843 (3)gb:AP004054_18370132e-51Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ12
JMSF015K15Sequence471004350 (2)gb:AY120774_15796563e-59Arabidopsis thaliana unknown protein (At1g79690) mRNA, complete cds.>gb:BT000142759011843 (3)gb:AP004054_18370132e-44Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ12

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF013F05+ CTGCAAGAGCTCCACTCAGCGCT
                      ____________________________________________________________
consensus CTGCAAGAGCTCCACTCAGCGCT
 
. : . : . : . : . : . :
rJMSF013F05+ AGAAGAAACTAAAGCCGACATTGTTGGACTGTGGGCCCTAAAGTTTCTAATTGGCGAGGG
                      ____________________________________________________________
consensus AGAAGAAACTAAAGCCGACATTGTTGGACTGTGGGCCCTAAAGTTTCTAATTGGCGAGGG
 
. : . : . : . : . : . :
rJMSF013F05+ TTTGCTTCCGAAGAGCCTAGTGAGATCGATGTATGTCTCTTTTCTTGCTGGATGTTTTCG
                      ____________________________________________________________
consensus TTTGCTTCCGAAGAGCCTAGTGAGATCGATGTATGTCTCTTTTCTTGCTGGATGTTTTCG
 
. : . : . : . : . : . :
rJMSF013F05+ CTCTGTGCGCTTTGGATTAGAGGAAGCTCATGGCAAAGGGCAGGCGCTGCAGTTCAATTA
                      ____________________________________________________________
consensus CTCTGTGCGCTTTGGATTAGAGGAAGCTCATGGCAAAGGGCAGGCGCTGCAGTTCAATTA
 
. : . : . : . : . : . :
rJMSF013F05+ TATGTTCGAGAAAATTGCCTTTGTCTTACAACCTGATGAGACCTTCTCCATCGACTTCGA
                      ____________________________________________________________
consensus TATGTTCGAGAAAATTGCCTTTGTCTTACAACCTGATGAGACCTTCTCCATCGACTTCGA
 
. : . : . : . : . : . :
rJMSF013F05+ TAAGGCAAGATTTTGTGATCTGTTAGGATTAAACGTAACCATTCGAAGCAAAATGTTTAT
                      ____________________________________________________________
consensus TAAGGCAAGATTTTGTGATCTGTTAGGATTAAACGTAACCATTCGAAGCAAAATGTTTAT
 
. : . : . : . : . : . :
rJMSF013F05+ TTTTCCTATTGTGAAAGGTCGAGGATGTTGTCGAGAGCTTGAGTAGGGAAATCCTTACAG
rJMSF001L22+ AAGGTCGAGGATGTTGTCGAGAGCTTGAGTAGGGAAATCCTTACAG
rJMSF015K15+ AAGGTCGAGGATGTTGTCGAGAGCTTGAGTAGGGAAATCCTTACAG
                      ____________________________________________________________
consensus TTTTCCTATTGTGAAAGGTCGAGGATGTTGTCGAGAGCTTGAGTAGGGAAATCCTTACAG
 
. : . : . : . : . : . :
rJMSF013F05+ TACAAGCAAGAGGCGATAAAGATGGTGCCCAAATGCTTCTTAAGAAATATGGCGTTATGA
rJMSF001L22+ TACAAGCGAGAGGCGATAAAGATGGTGCCCAAATGCTTCTTAAGAAATATGGCGTTATGA
rJMSF015K15+ TACAAGCGAGAGGCGATAAAGATGGTGCCCAAATGCTTCTTAAGAAATATGGCGTTATGA
                      ____________________________________________________________
consensus TACAAGCGAGAGGCGATAAAGATGGTGCCCAAATGCTTCTTAAGAAATATGGCGTTATGA
 
. : . : . : . : . : . :
rJMSF013F05+ CTCCTCCACTGCAATGTGCACTCCAAAAACTGGAAACGATTCAGGTTCCGGTGGACATAG
rJMSF001L22+ CTCCTCCACTACAATGTGCACTCCAAAAACTGGAAACAATTCAGGTTCCGGTGGACATAG
rJMSF015K15+ CTCCTCCACTACAATGTGCACTCCAAAAACTGGAAACAATTCAGGTTCCGGTGGACATAG
                      ____________________________________________________________
consensus CTCCTCCACTACAATGTGCACTCCAAAAACTGGAAACAATTCAGGTTCCGGTGGACATAG
 
. : . : . : . : . : . :
rJMSF013F05+ TTCCTGAATTTCCCGTTGCTGATCAAATTTTACGTGAAAGCCATTGAGGACTTGACATTA
rJMSF001L22+ TTCCTGAATTTCCCATTGCTGATCAAATTTTACGTGAAAGCCATTGAGGACTTGACATTA
rJMSF015K15+ TTCCTGAATTTCCCATTGCTGATCAAATTTTACGTGAAAGCCATTGAGGACTTGACATTA
                      ____________________________________________________________
consensus TTCCTGAATTTCCCATTGCTGATCAAATTTTACGTGAAAGCCATTGAGGACTTGACATTA
 
. : . : . : . : . : . :
rJMSF013F05+ TAAACTGTTCTTGAAGGAGGAGCACAGGCAGAGAGAGAGAGAGATCATTAACTATGTGTA
rJMSF001L22+ TAAACTGTTCTTGAAGGAGGAGCACAGGCA------GAGAGAGAACATTAACTATGTGTA
rJMSF015K15+ TAAACTGTTCTTGAAGGAGGAGCACAGGCA------GAGAGAGAACATTAACTATGTGTA
                      ____________________________________________________________
consensus TAAACTGTTCTTGAAGGAGGAGCACAGGCA------GAGAGAGAACATTAACTATGTGTA
 
. : . : . : . : . : . :
rJMSF013F05+ AGATAAAAATCATAAAATGATGGGGTTTTTATGCTGTTGTGAACAGAAGTTGCATCAATA
rJMSF001L22+ AGA---------TAAAATGATGGGGTTTTTATGCTGTTGTGAACAGAAGTTGCATCAATA
rJMSF015K15+ AGA---------TAAAATGATGGGGTTTTTATGCTGTTGTGAACAGAAGTTGCATCAATA
                      ____________________________________________________________
consensus AGA---------TAAAATGATGGGGTTTTTATGCTGTTGTGAACAGAAGTTGCATCAATA
 
. : . : . : . : . : . :
rJMSF013F05+ ATGTGGGATTTGTATGTTTAGAACTGAAAACA
rJMSF001L22+ ATGTGGGATTTGTATGTTTAGAACTGAAAACAGAAGCTAAGATCTTGTGGTCTAATGGCA
rJMSF015K15+ ATGTGGGATTTGTATGTTTAGAACTGAAAACAGAAGCTAAGATCTTGTGGTCTAATGGCA
                      ____________________________________________________________
consensus ATGTGGGATTTGTATGTTTAGAACTGAAAACAGAAGCTAAGATCTTGTGGTCTAATGGCA
 
. : . : . : . : . : . :
rJMSF001L22+ CTAAGGTTGCACTCTCATATGGGTTGTTGTGAGTTCGAGCCTCAGTGGAGGCGACATTGA
rJMSF015K15+ CTAAGGTTGCACTCTCATATGGGTTGTTGTGAGTTCGAGCCTCAGTGGAGGCGACATTGA
                      ____________________________________________________________
consensus CTAAGGTTGCACTCTCATATGGGTTGTTGTGAGTTCGAGCCTCAGTGGAGGCGACATTGA
 
. : . : . : . : . : . :
rJMSF001L22+ CTCTTTGTGTTTCAGTAGGTTAAGAAAGTAGTTATGCACAGATACTACAATGTGTTACTT
rJMSF015K15+ CTCTTTGTGTTTCAGTAGGTTAAGAAAGTAGTTATGCACAGATACTACAATGTGTTACTT
                      ____________________________________________________________
consensus CTCTTTGTGTTTCAGTAGGTTAAGAAAGTAGTTATGCACAGATACTACAATGTGTTACTT
 
. : . : . : . : . : . :
rJMSF001L22+ TT
rJMSF015K15+ TTTGTGGTTTGAGCCGGCGGTCAGCTACAAGCTTGATTGAATCGAACTTGTAATTTTCCG
                      ____________________________________________________________
consensus TTTGTGGTTTGAGCCGGCGGTCAGCTACAAGCTTGATTGAATCGAACTTGTAATTTTCCG