Previous Contig 011839:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFN037H14Sequence380011839 (2)gb:AY057697_15641093e-17Arabidopsis thaliana AT4g13250/F17N18_140 mRNA, complete cds.
JMSF015K03Sequence482018940gb:AY057697_15641096e-11Arabidopsis thaliana AT4g13250/F17N18_140 mRNA, complete cds.774011839 (2)gb:AP002900_18237268e-90Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P044

Alignment

This contig is upended


. : . : . : . : . : . :
JMFN037H14+ ATTTCATTTGTTTACATTTTACAGAATCCAAGTTTTGGTACATCCAATGCAGAG
rJMSF015K03- ATTTCATTTCTTTACATTTTACAGAATCCAAGTTTTGGTACATCCAATGCAGAG
                      ____________________________________________________________
consensus ATTTCATTTGTTTACATTTTACAGAATCCAAGTTTTGGTACATCCAATGCAGAG
 
. : . : . : . : . : . :
JMFN037H14+ AATGTAGACAGGAATGAATCGGAAGGAATGATTGAGGAGGCCTCGTGGTTTCTGGGAATC
rJMSF015K03- AATGTAGACAGGAATGAATCGGAAGGAATGATTGAGGAGGCCTCGTGGTTTCTGGGAATC
                      ____________________________________________________________
consensus AATGTAGACAGGAATGAATCGGAAGGAATGATTGAGGAGGCCTCGTGGTTTCTGGGAATC
 
. : . : . : . : . : . :
JMFN037H14+ AATCTAAGGGGTTCTAGCGTGGGTTTAGTGTTTCTCTTTTGGCTAAAATACCAAGTAGCA
rJMSF015K03- AATCTAAGGGGTTCTAACGTGGGTTTAGTGTTTCTCTTTTGGCTAAAATACCAAGTAGCA
                      ____________________________________________________________
consensus AATCTAAGGGGTTCTAGCGTGGGTTTAGTGTTTCTCTTTTGGCTAAAATACCAAGTAGCA
 
. : . : . : . : . : . :
JMFN037H14+ GAACAGGTTTAAGATTTCTGCGCGAATCCAGGTTTAGGTGCCAGGATATGTGCTACCTGT
rJMSF015K03- GAACAGGTTTAAGATTTCTACGCGAATCCAGGTTTAGGTGCCAGGATATGTGCTACCTGT
                      ____________________________________________________________
consensus GAACAGGTTTAAGATTTCTGCGCGAATCCAGGTTTAGGTGCCAGGATATGTGCTACCTGT
 
. : . : . : . : . : . :
JMFN037H14+ GCTCGATAGAATGATGAAAGCGCAAACCACAGAAAGCGAGAACACAGAAACCCAAGTATT
rJMSF015K03- GCTCGATAGAATGATGAAAGCGCAAACCACAGAAAGCGAGAACACAGAAACCCAAGTATT
                      ____________________________________________________________
consensus GCTCGATAGAATGATGAAAGCGCAAACCACAGAAAGCGAGAACACAGAAACCCAAGTATT
 
. : . : . : . : . : . :
JMFN037H14+ TTCGGTGTACGTCTCCATGGCATCGGTGAATGACAAGCGAGTGCGGCTCTCAGCCCAGTT
rJMSF015K03- TTCGGTGTACGTCTCCATGGCATCGGTGAATGACAAGCGAGTGCGGCTCTCAGCCCAGTT
                      ____________________________________________________________
consensus TTCGGTGTACGTCTCCATGGCATCGGTGAATGACAAGCGAGTGCGGCTCTCAGCCCAGTT
 
. : . : . : . : . : . :
JMFN037H14+ TCGAAGCCTATCCGCCTCTGCAGCAT
rJMSF015K03- TCGAAGCCTATCCGCCTCTGCAGCATACACAGCTCTTCCCTGGTCATCGAACCAACGGCC
                      ____________________________________________________________
consensus TCGAAGCCTATCCGCCTCTGCAGCATACACAGCTCTTCCCTGGTCATCGAACCAACGGCC
 
. : . : . : . : . : . :
rJMSF015K03- TCGTCTCAGCCAAGCGCTAACCAAAGCGATTAATATCCTTGGCGGGGTCAAATAATTAAT
                      ____________________________________________________________
consensus TCGTCTCAGCCAAGCGCTAACCAAAGCGATTAATATCCTTGGCGGGGTCAAATAATTAAT
 
. : . : . : . : . : . :
rJMSF015K03- AGCCTTGCCACTTCCTTTCACAATCCGCATCCGTGGTACTAGAGTTCGAGCCACAGTCTC
                      ____________________________________________________________
consensus AGCCTTGCCACTTCCTTTCACAATCCGCATCCGTGGTACTAGAGTTCGAGCCACAGTCTC
 
. : . : . : . : . : . :
rJMSF015K03- GGGGAGCTCGCAGATGATGTTAAACATCTGCTTATTTTGAACACTCGATCCACTCAACAG
                      ____________________________________________________________
consensus GGGGAGCTCGCAGATGATGTTAAACATCTGCTTATTTTGAACACTCGATCCACTCAACAG
 
. : . : . : . : . : . :
rJMSF015K03- CAAATCTGTCAAAACCATGCCTGGGGAGGCAGTGTGCACTCCAACTTTTGATCGCTTGCA
                      ____________________________________________________________
consensus CAAATCTGTCAAAACCATGCCTGGGGAGGCAGTGTGCACTCCAACTTTTGATCGCTTGCA
 
. : . : . : . : . : . :
rJMSF015K03- CTCCTTGAAAAGTGACGATTGAAGCTGCCTAAGACCGCATTTTGTTGACCCGTATACAGC
                      ____________________________________________________________
consensus CTCCTTGAAAAGTGACGATTGAAGCTGCCTAAGACCGCATTTTGTTGACCCGTATACAGC
 
. : . : . : . : . : . :
rJMSF015K03- CGTCAGAGGAGTGCTAGACCCCCCGGATCCGGCACCATCCATGTTAAATACGTGACCCCC
                      ____________________________________________________________
consensus CGTCAGAGGAGTGCTAGACCCCCCGGATCCGGCACCATCCATGTTAAATACGTGACCCCC