Previous Contig 011833:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF015I22Sequence250011833 (2)749011833 (2)gb:AY086684_15717287e-32Arabidopsis thaliana clone 2681 mRNA, complete sequence.>gb:AY136465_1581965 Ara

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF015I22- GACAGTTGGAGCGTTGCCCGACGTCTATCTATCTGGTGCCGGCGGAGGACATGGTAGGA
                      ____________________________________________________________
consensus GACAGTTGGAGCGTTGCCCGACGTCTATCTATCTGGTGCCGGCGGAGGACATGGTAGGA
 
. : . : . : . : . : . :
JMSF015I22- ATACTCTATTCCGCAGCTCCGCTCACTCATTACTGCAACACACGCTTCTTCATAGCCGCC
rJMSF015I22+ ACTGCAACACACGCTTCTTCATAGCCGCC
                      ____________________________________________________________
consensus ATACTCTATTCCGCAGCTCCGCTCACTCATTACTGCAACACACGCTTCTTCATAGCCGCC
 
. : . : . : . : . : . :
JMSF015I22- GCCGGCGGAGGAATCAAATTCACCCGCGATTCTCAACGGAAAGGATCACCGGCGTGCATT
rJMSF015I22+ GCCGGCGGAGGAATCAAATTCACCCGCGATTCTCAACGGAAAGGATCACCGGCGTGCATT
                      ____________________________________________________________
consensus GCCGGCGGAGGAATCAAATTCACCCGCGATTCTCAACGGAAAGGATCACCGGCGTGCATT
 
. : . : . : . : . : . :
JMSF015I22- GCACCTAATCCGGCGACTAACTGCATCGTCCGACCGATAACTGCAGCATTGCTGGCGGCA
rJMSF015I22+ GCACCTAATCCGGCGACTAACTGCATCGTCCGACCGATAACTGCAGCATTGCTGGCGGCA
                      ____________________________________________________________
consensus GCACCTAATCCGGCGACTAACTGCATCGTCCGACCGATAACTGCAGCATTGCTGGCGGCA
 
. : . : . : . : . : . :
JMSF015I22- ACCGCGTGCGC
rJMSF015I22+ ACCGCGTGCGCCGTGGTATTGGGCGGCCGAGCTGACGCGGTGGAGCTTACTGGAGCTCAA
                      ____________________________________________________________
consensus ACCGCGTGCGCCGTGGTATTGGGCGGCCGAGCTGACGCGGTGGAGCTTACTGGAGCTCAA
 
. : . : . : . : . : . :
rJMSF015I22+ CAGCAAGCCGACATGGAGACGCTTTCCAATATACCGCAGACGCTATCAAGCGAATGCGAG
                      ____________________________________________________________
consensus CAGCAAGCCGACATGGAGACGCTTTCCAATATACCGCAGACGCTATCAAGCGAATGCGAG
 
. : . : . : . : . : . :
rJMSF015I22+ GGCGGGGATTGTGCGAAGAAGGATAGGATTCAACGGCCGAAATCGAAGCAGGCAGAGACC
                      ____________________________________________________________
consensus GGCGGGGATTGTGCGAAGAAGGATAGGATTCAACGGCCGAAATCGAAGCAGGCAGAGACC
 
. : . : . : . : . : . :
rJMSF015I22+ TGCACCGTCAAATGTGTTAATACTTGCATTCGCGGCGGCTACGGGTCGCCAGGCGAAGGT
                      ____________________________________________________________
consensus TGCACCGTCAAATGTGTTAATACTTGCATTCGCGGCGGCTACGGGTCGCCAGGCGAAGGT
 
. : . : . : . : . : . :
rJMSF015I22+ CCGCTCAATGTTAGAAGCAGGCCTCTGGTAGTGTTCAAGAATGGGTTCCGGAGCCGGCAT
                      ____________________________________________________________
consensus CCGCTCAATGTTAGAAGCAGGCCTCTGGTAGTGTTCAAGAATGGGTTCCGGAGCCGGCAT
 
. : . : . : . : . : . :
rJMSF015I22+ TACTGTTTGGTGGAGTGTTCTGATATATGCAATCTGATTAGAGATGGTGAAGATGGACCA
                      ____________________________________________________________
consensus TACTGTTTGGTGGAGTGTTCTGATATATGCAATCTGATTAGAGATGGTGAAGATGGACCA
 
. : . : . : . : . : . :
rJMSF015I22+ TAGTGTTTGCACTCTGTCCATATAATTTCTCCAATCCCAACTCTATCATACTGAAGGATG
                      ____________________________________________________________
consensus TAGTGTTTGCACTCTGTCCATATAATTTCTCCAATCCCAACTCTATCATACTGAAGGATG
 
. : . : . : . : . : . :
rJMSF015I22+ GTAAGCAGGGCTGAGTTGTAAACAGAAAATGTGGAGGTTATGGATCGAGTCACACAGATA
                      ____________________________________________________________
consensus GTAAGCAGGGCTGAGTTGTAAACAGAAAATGTGGAGGTTATGGATCGAGTCACACAGATA
 
. : . : . : . : . : . :
rJMSF015I22+ ATCTATCCACACATTATAATGTGGAGACTCCAAGCCTCCCTTCACCTATAGTTCTTTCTT
                      ____________________________________________________________
consensus ATCTATCCACACATTATAATGTGGAGACTCCAAGCCTCCCTTCACCTATAGTTCTTTCTT
 
. : . : . : . : . : . :
rJMSF015I22+ TTAGCCCTTAGTTTTGATGCAGAAACCCTTAAAGCAACTGTGTATCTGATTTGTTTATAC
                      ____________________________________________________________
consensus TTAGCCCTTAGTTTTGATGCAGAAACCCTTAAAGCAACTGTGTATCTGATTTGTTTATAC