Previous Contig 011826:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF005B14Sequence252004672 (3)gb:AF360339_17912850.005Arabidopsis thaliana unknown protein (At1g15740) mRNA, complete cds.340011826 (3)gb:AF360339_17912853e-04Arabidopsis thaliana unknown protein (At1g15740) mRNA, complete cds.
JMSF015H06Sequence552004672 (3)gb:AF360339_17912857e-37Arabidopsis thaliana unknown protein (At1g15740) mRNA, complete cds.739011826 (3)gb:AF360339_17912854e-25Arabidopsis thaliana unknown protein (At1g15740) mRNA, complete cds.
JMSF043C20Sequence816004672 (3)gb:AF360339_17912856e-69Arabidopsis thaliana unknown protein (At1g15740) mRNA, complete cds.838011826 (3)gb:AF360339_17912855e-42Arabidopsis thaliana unknown protein (At1g15740) mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF043C20+ CTCGCAGGGTTAAGCCATTTGGAGAGTTTGAACCTGTCG
                      ____________________________________________________________
consensus CTCGCAGGGTTAAGCCATTTGGAGAGTTTGAACCTGTCG
 
. : . : . : . : . : . :
rJMSF043C20+ TTCACTGTTATAACGGACAATGGGTTGAGAAAGTTAANGGGGGTTGTCATCACTGAGATC
                      ____________________________________________________________
consensus TTCACTGTTATAACGGACAATGGGTTGAGAAAGTTAANGGGGGTTGTCATCACTGAGATC
 
. : . : . : . : . : . :
rJMSF043C20+ ACTTAATTTGGATGCTCGCCAGATTACTGATGCCGGACTTGCCGCTCTTACGAGTTTGAC
                      ____________________________________________________________
consensus ACTTAATTTGGATGCTCGCCAGATTACTGATGCCGGACTTGCCGCTCTTACGAGTTTGAC
 
. : . : . : . : . : . :
rJMSF043C20+ TGGTTTAATGCATTTGGATCTCTTTGGAGCTCGTATTACTGATTCCGGGACAAACTATTT
rJMSF015H06+ ATTCCGGGACNAACTATTT
                      ____________________________________________________________
consensus TGGTTTAATGCATTTGGATCTCTTTGGAGCTCGTATTACTGATTCCGGGACAAACTATTT
 
. : . : . : . : . : . :
rJMSF043C20+ AAAGCATTTCAAGAACCTGCGATCTCTGGAAATTTGCGGTGGAGGCTTGACTGATGCTGG
rJMSF015H06+ AAAGCATTTCAAGAACCTGCGATCTCTGGAAATTTGCGGTGGAGGCTTGACTGATGCTGG
                      ____________________________________________________________
consensus AAAGCATTTCAAGAACCTGCGATCTCTGGAAATTTGCGGTGGAGGCTTGACTGATGCTGG
 
. : . : . : . : . : . :
rJMSF043C20+ CGTGAAAAACATCAAAGATCTTACGGCCCTCAATTTGCTAAATCTTTCACAGAACAGTCA
rJMSF015H06+ CGTGAAAAACATCAAAGATCTTACGGCCCTCAATTTGCTAAATCTTTCACAGAACAGTCA
                      ____________________________________________________________
consensus CGTGAAAAACATCAAAGATCTTACGGCCCTCAATTTGCTAAATCTTTCACAGAACAGTCA
 
. : . : . : . : . : . :
rJMSF043C20+ CCTCACAGATAAAAGCTTGGAAGCAATTTCCGGGCTGACATCGCTGGTGTCTCTTAATGT
rJMSF015H06+ CCTCACAGATAAAAGCTTGGAAGCAATTTCCGGGCTGACATCGCTGGTGTCTCTTAATGT
                      ____________________________________________________________
consensus CCTCACAGATAAAAGCTTGGAAGCAATTTCCGGGCTGACATCGCTGGTGTCTCTTAATGT
 
. : . : . : . : . : . :
rJMSF043C20+ ATCAAACTCTCGCATTACGAGTGCGGGGTTGCAACATCTGAAGCCACTCAAGAAACTGAA
rJMSF015H06+ ATCAAACTCTCGCATTACGAGTGCGGGGTTGCAACATCTGAAGCCACTCAAGAAACTGAA
                      ____________________________________________________________
consensus ATCAAACTCTCGCATTACGAGTGCGGGGTTGCAACATCTGAAGCCACTCAAGAAACTGAA
 
. : . : . : . : . : . :
rJMSF043C20+ GTCGCTTACACTGGAGTCGTGTAAGGTGACTGCAAACGACATCAAGAAACTCCAGTCCAC
rJMSF005B14+ AAGGTGACTGCAAACGACATCAAGAAACTCCAGTCCAC
rJMSF015H06+ GTCGCTTACACTGGAGTCGTGTAAGGTGACTGCAAACGACATCAAGAAACTCCAGTCCAC
                      ____________________________________________________________
consensus GTCGCTTACACTGGAGTCGTGTAAGGTGACTGCAAACGACATCAAGAAACTCCAGTCCAC
 
. : . : . : . : . : . :
rJMSF043C20+ CGACCTCCCGAATCTGGTGAATTATAGGCCCGAATGATACGTCAAGATGGGAACGTTAAA
rJMSF005B14+ CGACCTCCCGAATCTGGTGAATTATAGGCCCGAATGATACGTCAAGATGGGAACGTTAAA
rJMSF015H06+ CGACCTCCCGAATCTGGTGAATTATAGGCCCGAATGATACGTCAAGATGGGAACGTTAAA
                      ____________________________________________________________
consensus CGACCTCCCGAATCTGGTGAATTATAGGCCCGAATGATACGTCAAGATGGGAACGTTAAA
 
. : . : . : . : . : . :
rJMSF043C20+ TTATCTGCTCAGCTCAGCATTGAGAAGCTGCTGTACATAGACCAGTAATAGTCTGTTCTG
rJMSF005B14+ TTATCTGCTCAGCTCAGCATTGAGAAGCTGCTGTACATAGACCAGTAATAGTCTGTTCTG
rJMSF015H06+ TTATCTGCTCAGCTCAGCATTGAGAAGCTGCTGTACATAGACCAGTAATAGTCTGTTCTG
                      ____________________________________________________________
consensus TTATCTGCTCAGCTCAGCATTGAGAAGCTGCTGTACATAGACCAGTAATAGTCTGTTCTG
 
. : . : . : . : . : . :
rJMSF043C20+ TTCTGTTTGGTTCCATGCTGGATGTGAAGCTCTCTTTTGTATGGGAACTCATATGAAAAA
rJMSF005B14+ TTCTGTTTGGTTCCATGCTGGATGTGAAGCTCTCTTTTGTATGGGAACTCATATGAAAAA
rJMSF015H06+ TTCTGTTTGGTTCCATGCTGGATGTGAAGCTCTCTTTTGTATGGGAACTCATATGAAAAA
                      ____________________________________________________________
consensus TTCTGTTTGGTTCCATGCTGGATGTGAAGCTCTCTTTTGTATGGGAACTCATATGAAAAA
 
. : . : . : . : . : . :
rJMSF043C20+ GAAGGTAGATAAAAGCTTCCATGGCATGGAGTATGGATTGCAGTCTCTCAACTCATCACT
rJMSF005B14+ GAAGGTAGATAAAAGCTTCCATGGCATGGAGTATGGATTGCAGTCTCTCAACTCATCACT
rJMSF015H06+ GAAGGTAGATAAAAGCTTCCATGGCATGGAGTATGGATTGCAGTCTCTCAACTCATCACT
                      ____________________________________________________________
consensus GAAGGTAGATAAAAGCTTCCATGGCATGGAGTATGGATTGCAGTCTCTCAACTCATCACT
 
. : . : . : . : . : . :
rJMSF043C20+ ATTTCCCTCTGTACATATTTCCCATCATTATGGTATGATGTTTGCTGTTTATTACTTGTG
rJMSF005B14+ ATTTCCCTCTGTACATATTTCCCATCATTATGGTATGATGTTTGCTGTTTATTAC
rJMSF015H06+ ATTTCCCTCTGTACATATTTCCCATCATTATGGTATGATGTTTGCTGTTTATTACTTGTG
                      ____________________________________________________________
consensus ATTTCCCTCTGTACATATTTCCCATCATTATGGTATGATGTTTGCTGTTTATTACTTGTG
 
. : . : . : . : . : . :
rJMSF043C20+ TTTTTAGCAAGTAAAAA
rJMSF015H06+ TTTTTAGCAAGTTAAAAATAATAACATGGAGTTGCTACTAGTAAAATTTTGTCAGTATCA
                      ____________________________________________________________
consensus TTTTTAGCAAGTTAAAAATAATAACATGGAGTTGCTACTAGTAAAATTTTGTCAGTATCA
 
. : . : . : . : . : . :
rJMSF015H06+ TATGTTTACTTTATGCTTTTTGTCAGTATCTTGTATTTCTAACAAAACATAACATACAAC
                      ____________________________________________________________
consensus TATGTTTACTTTATGCTTTTTGTCAGTATCTTGTATTTCTAACAAAACATAACATACAAC