Previous Contig 011818:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF015E24Sequence443011818 (4)gb:OSJN00114_16951524e-05Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0035O13, complete seque739011818 (4)pir|T01879|T018792e-08hypothetical protein F8M12.17 - Arabidopsis thaliana>gb:F8M12_1678644 Arabidopsi
JMSF051D20Sequence638011818 (4)751011818 (4)

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF051D20- GGGAATCCCTAGACTCTAGTTCAATACTCAGCCTTCGCCCTTCAGCCCTGCGAC
                      ____________________________________________________________
consensus GGGAATCCCTAGACTCTAGTTCAATACTCAGCCTTCGCCCTTCAGCCCTGCGAC
 
. : . : . : . : . : . :
JMSF015E24- CTCC
JMSF051D20- TCATCTGTCTCTCTGTCTCTCTGTCTCTCTACCGCAATTCTCCACTCTCCACTCAGCTCC
                      ____________________________________________________________
consensus TCATCTGTCTCTCTGTCTCTCTGTCTCTCTACCGCAATTCTCCACTCTCCACTCAGCTCC
 
. : . : . : . : . : . :
JMSF015E24- ACCGGCGGCCGGCC-TATTCTTCTCCGTCTGGCGTCTGCTACTCTGCTCCGTTTCCCTTT
JMSF051D20- ACCGGCGGCCGGCCTTAGTTTTCTCCGTCTGGCGTCTGCTACTCTGATTCGTTTCCC-TT
                      ____________________________________________________________
consensus ACCGGCGGCCGGCCTTATTTTTCTCCGTCTGGCGTCTGCTACTCTGCTTCGTTTCCCTTT
 
. : . : . : . : . : . :
JMSF015E24- TGGTTTTCCTAACCCGCAAAGGCCCAAACCAAACATCAGAGGTTAGGGTTTCTGTCACTT
JMSF051D20- TGGCTTTCCTAATTCGCAAAGGCCCAGACCAAACATCAGAGGTCAGGGTTTCTCT-GCTT
                      ____________________________________________________________
consensus TGGTTTTCCTAATTCGCAAAGGCCCAGACCAAACATCAGAGGTTAGGGTTTCTGTCGCTT
 
. : . : . : . : . : . :
JMSF015E24- TTCCCTCAATCTCTGTATTCTTCCCAACT-----CTTCCTAATTTCC-TTTTATTTACGA
JMSF051D20- TTCCC-CAATCTCTGTTTTCTTCCCAACTCTTAGCTTCCGAATGTCCTTTTTATTTACGA
                      ____________________________________________________________
consensus TTCCCTCAATCTCTGTTTTCTTCCCAACTCTTAGCTTCCTAATTTCCTTTTTATTTACGA
 
. : . : . : . : . : . :
JMSF015E24- AATACGACATCTTGCCGTTGAAGAATAGAACGATTTTAGCTTTTGATTTCGACTTGCGCC
JMSF051D20- AATATGGAATCTTGCAGTTGAACAATAGAATGATTTTAGGTTTCGATTTCGACCGACGCC
                      ____________________________________________________________
consensus AATATGGCATCTTGCCGTTGAAGAATAGAATGATTTTAGGTTTTGATTTCGACTTGCGCC
 
. : . : . : . : . : . :
JMSF015E24- TCATTGTTGTTTCAATTTAATGGCTCAACATCGGCTTCTCAAAACCGCACCGGATGCAAG
JMSF051D20- TCATTGTTCTTTCAAATTAATGGC------TCGGCGACTCAAAACCGTACGGGATGCAAG
rJMSF051D20+ CTCAAAACCGTACGGGATGCAAG
                      ____________________________________________________________
consensus TCATTGTTGTTTCAATTTAATGGCTCAACATCGGCTTCTCAAAACCGTACGGGATGCAAG
 
. : . : . : . : . : . :
JMSF015E24- TAAGGATTTAATAAGTGAGCTGCCGGTAGGGGTAAAGGATAGAATTTTGGAGTGTTTGCC
JMSF051D20- TAGGGATTTAATAAGTGAGCTGCCCTTAGAGGTAAAGAACAGAATTTTGAGGTGTTTGCG
rJMSF051D20+ TAGGGATTTAATAAGTGAGCTGCCCTTAGAGGTAAAGAACAGAATTTTGAGGTGTTTGCG
                      ____________________________________________________________
consensus TAGGGATTTAATAAGTGAGCTGCCCTTAGAGGTAAAGAACAGAATTTTGAGGTGTTTGCG
 
. : . : . : . : . : . :
JMSF015E24- CA-CCCGAGACGCCGCCAGAACTGCTCTGCTCTCAAGGCACTGGAATGATCTTTGGTTGC
JMSF051D20- CATCTCCAGAGGCCGCCAGAACTGCTCTGCTCTCAAGGCAGTGGAATGATGTTTGGTTGC
rJMSF051D20+ CATCTCCAGAGGCCGCCAGAACTGCTCTGCTCTCAAGGCAGTGGAATGATGTTTGGTTGC
                      ____________________________________________________________
consensus CATCTCCAGAGGCCGCCAGAACTGCTCTGCTCTCAAGGCAGTGGAATGATGTTTGGTTGC
 
. : . : . : . : . : . :
JMSF015E24- AGCAT
JMSF051D20- AGCATGGACGGCTTACGTTTGATTGG
rJMSF051D20+ AGCATGGACGGCTTACGTTTGATTGGGAATTCTTGCAATGTGTCGAAGAGTGCTATGATG
                      ____________________________________________________________
consensus AGCATGGACGGCTTACGTTTGATTGGGAATTCTTGCAATGTGTCGAAGAGTGCTATGATG
 
. : . : . : . : . : . :
rJMSF051D20+ AAGTTATAGTTCCGTGGGAAGGATGACCAAGAAGCTGCTTCAAGGCTTTTGGAGGATCCA
rJMSF015E24+ GGATCCA
                      ____________________________________________________________
consensus AAGTTATAGTTCCGTGGGAAGGATGACCAAGAAGCTGCTTCAAGGCTTTTGGAGGATCCA
 
. : . : . : . : . : . :
rJMSF051D20+ GACGGTGGCTTTGTTATTCAGGAGCTGAAGATGCTTAACACAATCAAGATTGAATCATTC
rJMSF015E24+ AATGGTAGCTTTGTTATTCACGAGTTGAAGATGCTTAACACAATCAAGATTGAATCATTC
                      ____________________________________________________________
consensus GATGGTGGCTTTGTTATTCAGGAGTTGAAGATGCTTAACACAATCAAGATTGAATCATTC
 
. : . : . : . : . : . :
rJMSF051D20+ AGTGAATTCCCACTCGCAATGCTTTTTATAAAAATGTTGCTCTCAAAATCCCCTGTGCTA
rJMSF015E24+ AGTGAATCCGCATTTGAAATGCTCTTTATGAAAGTGTTGCTCTCAAAATCCCCAGCGCTA
                      ____________________________________________________________
consensus AGTGAATTCGCATTTGCAATGCTTTTTATGAAAGTGTTGCTCTCAAAATCCCCTGTGCTA
 
. : . : . : . : . : . :
rJMSF051D20+ AAGAGAGTTGTTATTGTGCAGTCTTGGCATAATATGAATGACTCCGAGGTGAGAAAAATC
rJMSF015E24+ GAGAGAGTTGTTATTGTGAAGTCTTGGG---GTACAAATG---CCCAGGCGAGAAAAATC
                      ____________________________________________________________
consensus GAGAGAGTTGTTATTGTGCAGTCTTGGGATAGTATGAATGACTCCGAGGTGAGAAAAATC
 
. : . : . : . : . : . :
rJMSF051D20+ CAAAGGAAGTTGGAATGCTTCCCTCGTGCATCTCCAAACGCACAAATTGTCTACGCGGGC
rJMSF015E24+ CAAAGGAAGTTGGAATGCTTCCCTCGTGCATCTCCAAACGCACAAATTGTCTGCACGGGC
                      ____________________________________________________________
consensus CAAAGGAAGTTGGAATGCTTCCCTCGTGCATCTCCAAACGCACAAATTGTCTGCGCGGGC
 
. : . : . : . : . : . :
rJMSF051D20+ AATTACTATGCG
rJMSF015E24+ AATTACTATGCGTCTATGCGTGATGATTGGATGGATACCCATGGTTTTGTCCTTTCAAGA
                      ____________________________________________________________
consensus AATTACTATGCGTCTATGCGTGATGATTGGATGGATACCCATGGTTTTGTCCTTTCAAGA
 
. : . : . : . : . : . :
rJMSF015E24+ ACTTAGTATGGTGAATCTCCCTGGGTTCTATTTGATTGCAGCTTAGAAATATTCAAAAAG
                      ____________________________________________________________
consensus ACTTAGTATGGTGAATCTCCCTGGGTTCTATTTGATTGCAGCTTAGAAATATTCAAAAAG
 
. : . : . : . : . : . :
rJMSF015E24+ GAGTTTTCCAGTCGATAACTTGAGAAGGTAACCTATTTATCAAATGATTAAGTTGCATGT
                      ____________________________________________________________
consensus GAGTTTTCCAGTCGATAACTTGAGAAGGTAACCTATTTATCAAATGATTAAGTTGCATGT
 
. : . : . : . : . : . :
rJMSF015E24+ AGAACACAATGATCTCAAAACTGCAAGGGGAGAGCTGCTTGGAATTTCAAAGCTCTAGCT
                      ____________________________________________________________
consensus AGAACACAATGATCTCAAAACTGCAAGGGGAGAGCTGCTTGGAATTTCAAAGCTCTAGCT
 
. : . : . : . : . : . :
rJMSF015E24+ ACATTTAACACATGTTCATGCTTTCTTTCTGCAATTGCATTCTGCCTGTGTTGTGGGGTG
                      ____________________________________________________________
consensus ACATTTAACACATGTTCATGCTTTCTTTCTGCAATTGCATTCTGCCTGTGTTGTGGGGTG