Previous Contig 011817:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFN011L02Sequence357011817 (2)
JMSF015E19Sequence247018920gb:AP005721_18565032e-36Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ11734011817 (2)gb:ATY14404_15575162e-71Arabidopsis thaliana ISA1 gene.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFN011L02+ CAAACAAGATGTATATGTAGCAAAATTTCGTCTATCAAGATTGAAACAATATCATTA
                      ____________________________________________________________
consensus CAAACAAGATGTATATGTAGCAAAATTTCGTCTATCAAGATTGAAACAATATCATTA
 
. : . : . : . : . : . :
JMFN011L02+ TGGCATATTACAATATTTGAATAAATTGGACTCAAAATTTAATTXXXXXXXXXXXXXXXX
                      ____________________________________________________________
consensus TGGCATATTACAATATTTGAATAAATTGGACTCAAAATTTAATTNNNNNNNNNNNNNNNN
 
. : . : . : . : . : . :
JMFN011L02+ XXGAAGAATCATGCCTACTACATATTTTATTGCTTCTCTTCACTGAAAGTTGACAATCAT
rJMSF015E19- AAGTTGACAATCAT
                      ____________________________________________________________
consensus NNGAAGAATCATGCCTACTACATATTTTATTGCTTCTCTTCACTGAAAGTTGACAATCAT
 
. : . : . : . : . : . :
JMFN011L02+ AATTTTCATTCTATATTATTGCTTACGTGTAATGCGAAGCATTCACTAGATACTAATATG
rJMSF015E19- AATTTTCATTCTATATTATTGCTTACGTGTAATGCGAAGCATTCACTAGATACTAATATG
                      ____________________________________________________________
consensus AATTTTCATTCTATATTATTGCTTACGTGTAATGCGAAGCATTCACTAGATACTAATATG
 
. : . : . : . : . : . :
JMFN011L02+ TATGTATACATCCTATACTATAAATTAATATCCTAGCAGGTAGGTCTTTTACACTAAATA
rJMSF015E19- TATGTATACATCCTATACTATAAATTAATATCCTAGCAGGTAGGTCTTTTACACTAAATA
                      ____________________________________________________________
consensus TATGTATACATCCTATACTATAAATTAATATCCTAGCAGGTAGGTCTTTTACACTAAATA
 
. : . : . : . : . : . :
JMFN011L02+ AATGGTGGGTGAACCGAGCCAAATCAGGTTTGGTGGGAAGGGATGCGGCGGCGAATTCTT
rJMSF015E19- AATGGTGGGTGAACCGAGCCAAATCAGGTTTGGTGGGAAGGGATGCGGCGGCGAATTCTT
                      ____________________________________________________________
consensus AATGGTGGGTGAACCGAGCCAAATCAGGTTTGGTGGGAAGGGATGCGGCGGCGAATTCTT
 
. : . : . : . : . : . :
rJMSF015E19- AGATACCCAAACTTTCCGGCACCAGGAGATGAACCTTCAAAGATAATTGGCAAATACCCA
                      ____________________________________________________________
consensus AGATACCCAAACTTTCCGGCACCAGGAGATGAACCTTCAAAGATAATTGGCAAATACCCA
 
. : . : . : . : . : . :
rJMSF015E19- GTTGCTGCTTTGTATCTTCGCTGAATCTCAAGAATCTTTTCGCTGCTGCGCAGAGAATTT
                      ____________________________________________________________
consensus GTTGCTGCTTTGTATCTTCGCTGAATCTCAAGAATCTTTTCGCTGCTGCGCAGAGAATTT
 
. : . : . : . : . : . :
rJMSF015E19- CTGCCAATTACACAAACAGTTCCACCAGATCCTCCGCCCGTGATTTTTGCACCATATAAA
                      ____________________________________________________________
consensus CTGCCAATTACACAAACAGTTCCACCAGATCCTCCGCCCGTGATTTTTGCACCATATAAA
 
. : . : . : . : . : . :
rJMSF015E19- GTCCCTTCAGCAGATTTTGATGCCTTAACATGCTGCACTTCTTGTACTAGCTGAACGAGC
                      ____________________________________________________________
consensus GTCCCTTCAGCAGATTTTGATGCCTTAACATGCTGCACTTCTTGTACTAGCTGAACGAGC
 
. : . : . : . : . : . :
rJMSF015E19- CTATTTGTTCCATCTGACCCTAGTCCACATGCACTGTAACTATAGTGGCACTGATACAAT
                      ____________________________________________________________
consensus CTATTTGTTCCATCTGACCCTAGTCCACATGCACTGTAACTATAGTGGCACTGATACAAT
 
. : . : . : . : . : . :
rJMSF015E19- AGTTCTCCAAGAGAAGAAAGCTGATCATCTGAAGTTGCAGATGTTAGCAATGCTTTAAAG
                      ____________________________________________________________
consensus AGTTCTCCAAGAGAAGAAAGCTGATCATCTGAAGTTGCAGATGTTAGCAATGCTTTAAAG
 
. : . : . : . : . : . :
rJMSF015E19- GCCTGCACACGAAAGTTCTCATATATAGGGTGTCTGGTAGCCGCCCTGACTCCATAGTTA
                      ____________________________________________________________
consensus GCCTGCACACGAAAGTTCTCATATATAGGGTGTCTGGTAGCCGCCCTGACTCCATAGTTA
 
. : . : . : . : . : . :
rJMSF015E19- CGTGTCTTGTCAATTACAGTGACAGGATCATGATGGTTTGCATATTTTTCAAGGAATGCA
                      ____________________________________________________________
consensus CGTGTCTTGTCAATTACAGTGACAGGATCATGATGGTTTGCATATTTTTCAAGGAATGCA
 
. : . : . : . : . : . :
rJMSF015E19- TCACCAAACATAGATTCGGGTAGCATTTTTCCATAAAGGGCTTCGTATCTGTGTGGAGAA
                      ____________________________________________________________
consensus TCACCAAACATAGATTCGGGTAGCATTTTTCCATAAAGGGCTTCGTATCTGTGTGGAGAA