Previous Contig 011816:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF013D10Sequence583011816 (36)sp|O49347|PSBY_ARATH5e-12Photosystem II core complex proteins psbY, chloroplast precursor (L- arginine me643011816 (36)sp|O49347|PSBY_ARATH9e-30Photosystem II core complex proteins psbY, chloroplast precursor (L- arginine me
JMFF032D21Sequence615011816 (36)sp|O49347|PSBY_ARATH3e-26Photosystem II core complex proteins psbY, chloroplast precursor (L- arginine me693011816 (36)sp|O49347|PSBY_ARATH6e-30Photosystem II core complex proteins psbY, chloroplast precursor (L- arginine me
JMFF050I13Sequence627011816 (36)599011816 (36)gb:AY087742_15727706e-24Arabidopsis thaliana clone 3813 mRNA, complete sequence.
JMFN006L24Sequence621011816 (36)sp|O49347|PSBY_ARATH5e-30Photosystem II core complex proteins psbY, chloroplast precursor (L- arginine me
JMFN007O07Sequence615011816 (36)sp|O49347|PSBY_ARATH2e-25Photosystem II core complex proteins psbY, chloroplast precursor (L- arginine me
JMFN008B10Sequence627011816 (36)sp|O49347|PSBY_ARATH5e-30Photosystem II core complex proteins psbY, chloroplast precursor (L- arginine me
JMFN009E11Sequence642011816 (36)sp|O49347|PSBY_ARATH5e-30Photosystem II core complex proteins psbY, chloroplast precursor (L- arginine me
JMFN010I08Sequence625011816 (36)sp|O49347|PSBY_ARATH6e-31Photosystem II core complex proteins psbY, chloroplast precursor (L- arginine me
JMFN011K09Sequence612011816 (36)gb:AY087742_15727701e-24Arabidopsis thaliana clone 3813 mRNA, complete sequence.
JMFN014H15Sequence614011816 (36)sp|O49347|PSBY_ARATH2e-22Photosystem II core complex proteins psbY, chloroplast precursor (L- arginine me
JMFN015P02Sequence596011816 (36)sp|O49347|PSBY_ARATH1e-24Photosystem II core complex proteins psbY, chloroplast precursor (L- arginine me
JMFN016G22Sequence612011816 (36)sp|O49347|PSBY_ARATH4e-24Photosystem II core complex proteins psbY, chloroplast precursor (L- arginine me
JMFN016N11Sequence605011816 (36)gb:AY087742_15727702e-29Arabidopsis thaliana clone 3813 mRNA, complete sequence.
JMFN017P09Sequence632011816 (36)sp|O49347|PSBY_ARATH5e-25Photosystem II core complex proteins psbY, chloroplast precursor (L- arginine me
JMFN018I13Sequence641011816 (36)sp|O49347|PSBY_ARATH5e-30Photosystem II core complex proteins psbY, chloroplast precursor (L- arginine me
JMFN019N23Sequence627011816 (36)sp|O49347|PSBY_ARATH8e-22Photosystem II core complex proteins psbY, chloroplast precursor (L- arginine me
JMFN025C23Sequence626011816 (36)gb:AY087742_15727702e-29Arabidopsis thaliana clone 3813 mRNA, complete sequence.
JMFN033L16Sequence618011816 (36)sp|O49347|PSBY_ARATH1e-21Photosystem II core complex proteins psbY, chloroplast precursor (L- arginine me
JMFN035P06Sequence644011816 (36)sp|O49347|PSBY_ARATH9e-25Photosystem II core complex proteins psbY, chloroplast precursor (L- arginine me
JMFN036B15Sequence594011816 (36)sp|O49347|PSBY_ARATH2e-26Photosystem II core complex proteins psbY, chloroplast precursor (L- arginine me
JMFN036D02Sequence545011816 (36)gb:AY087742_15727702e-19Arabidopsis thaliana clone 3813 mRNA, complete sequence.
JMFN036L20Sequence532011816 (36)gb:AY087742_15727704e-15Arabidopsis thaliana clone 3813 mRNA, complete sequence.
JMFN038C14Sequence613011816 (36)sp|O49347|PSBY_ARATH6e-21Photosystem II core complex proteins psbY, chloroplast precursor (L- arginine me
JMSF002N12Sequence281011816 (36)700011816 (36)sp|O49347|PSBY_ARATH6e-30Photosystem II core complex proteins psbY, chloroplast precursor (L- arginine me
JMSF015D21Sequence255005530 (4)736011816 (36)gb:ATAC002343_15427848e-33Arabidopsis thaliana chromosome IV BAC T19F6 genomic sequence, complete sequence
JMSF019E19Sequence250011816 (36)674011816 (36)sp|O49347|PSBY_ARATH6e-30Photosystem II core complex proteins psbY, chloroplast precursor (L- arginine me
JMSF029N07Sequence607006617 (2)gb:OSJN00292_16980722e-20Oryza sativa genomic DNA, chromosome 4, BAC clone: P0076O17, complete sequence.749011816 (36)gb:ATAC002343_15427849e-33Arabidopsis thaliana chromosome IV BAC T19F6 genomic sequence, complete sequence
JMSF034P04Sequence697011816 (36)sp|O49347|PSBY_ARATH4e-17Photosystem II core complex proteins psbY, chloroplast precursor (L- arginine me700011816 (36)sp|O49347|PSBY_ARATH6e-30Photosystem II core complex proteins psbY, chloroplast precursor (L- arginine me
JMSF036N13Sequence660006617 (2)sp|Q8L7G0|ARFA_ARATH1e-43Auxin response factor 1.>pir|D96621|D96621 auxin response factor 1 [imported] - 750011816 (36)pir|A84904|A849046e-28hypothetical protein At2g46530 [imported] - Arabidopsis thaliana>gb:AC006418_153
JMSF042K17Sequence412002098 (27)pir|G96669|G966697e-60protein F1N19.23 [imported] - Arabidopsis thaliana>gb:AE005173_894120 Arabidopsi758011816 (36)gb:ATAC002343_15427849e-33Arabidopsis thaliana chromosome IV BAC T19F6 genomic sequence, complete sequence

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF050I13- CCTTATGG
                      ____________________________________________________________
consensus CCTTATGG
 
. : . : . : . : . : . :
rJMFF050I13- CGGATCACCCTGGAGAGTTTTTTTTTTTTTTTTGGTTTAAGATTTGTTTATTTCCTTTTC
                      ____________________________________________________________
consensus CGGATCACCCTGGAGAGTTTTTTTTTTTTTTTTGGTTTAAGATTTGTTTATTTCCTTTTC
 
. : . : . : . : . : . :
rJMFF050I13- AATGAAGTATCACACATAGATTTCAAGAATCACCAGAGTAATTAAGCTGGTCTTCAAAAA
rJMFF013D10- AAAA
                      ____________________________________________________________
consensus AATGAAGTATCACACATAGATTTCAAGAATCACCAGAGTAATTAAGCTGGTCTTCAAAAA
 
. : . : . : . : . : . :
rJMFF050I13- AGAAAAAGTTGATTGATATTTGATACATACAAAATACTTGGGAAGTACATGTAAAGCAGG
JMFN025C23+ AAAAGTTGATTGATATTTGATACATACAAAATACTTGGGAAGTACATGTAAAGCAGG
JMFN016N11+ TGATTGATATTTGATACATACAAAATACTTGGGAAGTACATGTAAAGCAGG
rJMFF013D10- AG-AAAAAGTGATTGATATTTGATACATACAAAATACTTGGGAAGTACATGTAAAGCAGG
JMFN008B10+ ATTGATATTTGATACATACAAAATACTTGGGAAGTACATGTAAAGCAGG
JMFN018I13+ TTTGATACATACAAAATAC-TGGGAAGTACATGTAAAGCAGG
rJMFF032D21- ATTGATATTTGATACATACAAAATACTTGGGAAGTACATGTAAAGCAGG
JMFN010I08+ GTACATGTAAAGCAGG
JMFN009E11+ GGAAGTACATGTAAAGCAGG
JMFN017P09+ GGGAAGTACATGT-AAGCAGG
rJMSF002N12- CAAAATACTTGGGAAGTACATGTAAAGCAGG
JMFN035P06+ GTAAAGCAGG
rJMSF019E19- AATACTTGGGAAGTACATGTAAAGCAGG
rJMSF034P04- AAAATACTTGGGAAGTACATGTAAAGCAGG
                      ____________________________________________________________
consensus AGAAAAAGTTGATTGATATTTGATACATACAAAATACTTGGGAAGTACATGTAAAGCAGG
 
. : . : . : . : . : . :
rJMFF050I13- ACTATTATTCTGATCTCATCTTGTTGAGCTGGTTCAGAGCAGGCTGCAAAATGTTGTAAC
JMFN025C23+ ACTATTATTCTGATCTCATCTTGTTGAGCTGGTTCAGAGCAGGCTGCAAAATGTTGTAAC
JMFN016N11+ ACTATTATTCTGATCTCATCTTGTTGAGCTGGTTCAGAGCAGGCTGCAAAATGTTGTAAC
rJMFF013D10- ACTATTATTCTGATCTCATCTTGTTGAGCTGGTTCAGAGCAGGCTGCAAAATGTTGTAAC
JMFN008B10+ ACTATTATTCTGATCTCATCTTGTTGAGCTGGTTCAGAGCAGGCTGCAAAATGTTGTAAC
JMFN018I13+ ACTATTATTCTGATCTCATCTTGTTGAGCTGGTTCAGAGCAGGCTGCAAAATGTTGTAAC
rJMFF032D21- ACTATTATTCTGATCTCATCTTGTTGAGCTGGTTCAGAGCAGGCTGCAAAATGTTGTAAC
JMFN010I08+ ACTATTATTCTGATCTCATCTTGTTGAGCTGGTTCAGAGCAGGCTGCAAAATGTTGTAAC
JMFN009E11+ ACTATTATTCTGATCTCATCTTGTTGAGCTGGTTCAGAGCAGGCTGCAAAATGTTGTAAC
JMFN017P09+ ACTA-TATTCTGATCTCATC-TGTTGAGCTGG-TCAGAGCAGGCTGCANAATGTTGTAAC
JMFF032D21+ GGTTCAGAGCAGGCTGCAAAATGTTGTAAC
rJMSF002N12- ACTATTATTCTGATCTCATCTTGTTGAGCTGGTTCAGAGCAGGCTGCAAAATGTTGTAAC
JMFN035P06+ ACTATTATTCTGATCTCATCTTGTTGAGCTGGTTCAGAGCAGGCTGCAAAATGTT-TAAC
JMFN036B15+ GGTTCAGAGCAGGCTGCAAAATGTTGTAAC
JMFN006L24+ TGATCTCATCTTGTTGAGCTGGTTCAGAGCAGGCTGCAAAATGTTGTAAC
JMFN011K09+ TTCAGAGCAGGCTGCAAAATGTTGTAAC
JMFN015P02+ AGCAGGCTGCANAATGTTGTAAC
rJMSF019E19- ACTATTATTCTGATCTCATCTTGTTGAGCTGGTTCAGAGCAGGCTGCAAAATGTTGTAAC
JMFN014H15+ ATGTTGTAAC
JMFN033L16+ TCAGAGCAGGCTGCAAAATG-TGTAAC
JMFN016G22+ GCAGGCTGCANAATGTTGTAAC
JMFN007O07+ AGCAGGCTGCANAATGTTGTAAC
rJMSF034P04- ACTATTATTCTGATCTCATCTTGTTGAGCTGGTTCAGAGCAGGCTGCAAAATGTTGTAAC
JMFN019N23+ TGTTGTAAC
                      ____________________________________________________________
consensus ACTATTATTCTGATCTCATCTTGTTGAGCTGGTTCAGAGCAGGCTGCAAAATGTTGTAAC
 
. : . : . : . : . : . :
rJMFF050I13- CCACCCAGAGCAGAGCCGGGGCGACCACGATGAGCAAGAGTTGGCCCCTGCTGTCGTTGG
JMFN025C23+ CCACCCAGAGCAGAGCCGGGGCGACCACGATGAGCAAGAGTTGGCCCCTGCTGTCGTTGG
JMFN016N11+ CCACCCAGAGCAGAGCCGGGGCGACCACGATGAGCAAGAGTTGGCCCCTGCTGTCGTTGG
rJMFF013D10- CCACCCAGAGCAGAGCCGGGGCGACCACGATGAGCAAGAGTTGGCCCCTGCTGTCGTTGG
JMFN008B10+ CCACCCAGAGCAGAGCCGGGGCGACCACGATGAGCAAGAGTTGGCCCCTGCTGTCGTTGG
JMFN018I13+ CCACCCAGAGCAGAGCCGGGGCGACCACGATGAGCAAGAGTTGGCCCCTGCTGTCGTTGG
rJMFF032D21- CCACCCAGAGCAGAGCCGGGGCGACCACGATGAGCAAGAGTTGGCCCCTGCTGTCGTTGG
JMFN010I08+ CCACCCAGAGCAGAGCCGGGGCGACCACGATGAGCAAGAGTTGGCCCCTGCTGTCGTTGG
JMFN009E11+ CCACCCAGAGCAGAGCCGGGGCGACCACGATGAGCAAGAGTTGGCCCCTGCTGTCGTTGG
JMFN017P09+ CCACCCAGAGCAGAGCCGGGGCGACCACGATGAGCAAGAGTTGGCCCCTGCTGTCGTTGG
JMFF032D21+ CCACCCAGAGCAGAGCCGGGGCGACCACGATGAGCAAGAGTTGGCCCCTGCTGTCGTTGG
rJMSF002N12- CCACCCAGAGCAGAGCCGGGGCGACCACGATGAGCAAGAGTTGGCCCCTGCTGTCGTTGG
JMFN035P06+ CCACCCAGAGCAGAGCCGGGGCGACCACGATGAGCAAGAGTTGGCCCCTGCTGTCGTTGG
JMFN036B15+ CCACCCAGAGCAGAGCCGGGGCGACCACGATGAGCAAGAGTTGGCCCCTGCTGTCGTTGG
JMFN036D02+ CGGGGCGACCACGATGAGCAAGAGTTGGCCCCTGCTGTCGTTGG
JMFN036L20+ GATGAGCAAGAGTTGGCCCCTGCTGTCGTTGG
JMFN006L24+ CCACCCAGAGCAGAGCCGGGGCGACCACGATGAGCAAGAGTTGGCCCCTGCTGTCGTTGG
JMFN011K09+ CCACCCAGAGCAGAGCCGGGGCGACCACGATGAGCAAGAGTTGGCCCCTGCTGTCGTTGG
JMFN015P02+ CCACCCAGAGCAGAGCCGGGGCGACCACGATGAGCAAGAGTTGGCCCCTGCTGTCGTTGG
rJMSF019E19- CCACCCAGAGCAGAGCCGGGGCGACCACGATGAGCAAGAGTTGGCCCCTGCTGTCGTTGG
JMFN014H15+ CCACCCAGAGCAGAGCCGGGGCGACCACGATGAGCAAGAGTTGGCCCCTGCTGTCGTTGG
JMFN033L16+ CCACCCAGAGCAGAGCCGGGGCGACCACGATGAGCAAGAGTTGGCCCCTGCTGTCGTTGG
JMFN016G22+ CCACCCAGAGCAGAGCCGGGGCGACCACGATGAGCAAGAGTTGGCCCCTGCTGTCGTTGG
JMFN007O07+ CCACCCAGAGCAGAGCCGGGGCGACCACGATGAGCAAGAGTTGGCCCCTGCTGTCGTTGG
rJMSF034P04- CCACCCAGAGCAGAGCCGGGGCGACCACGATGAGCAAGAGTTGGCCCCTGCTGTCGTTGG
JMFN038C14+ CCAGAGCAGAGCCGGGGCGACCACGATGAGCAAGAGTTGGCCCCTGCTGTCGTTGG
JMFN019N23+ CCACCCAGAGCAGAGCCGGGGCGACCACGATGAGCAAGAGTTGGCCCCTGCTGTCGTTGG
                      ____________________________________________________________
consensus CCACCCAGAGCAGAGCCGGGGCGACCACGATGAGCAAGAGTTGGCCCCTGCTGTCGTTGG
 
. : . : . : . : . : . :
rJMFF050I13- CAGCATCGGCCAGTGCCGCCACTTCACTGGCAGCTGATGCGGCGTAGGGGTGAATGAACT
JMFN025C23+ CAGCATCGGCCAGTGCCGCCACTTCACTGGCAGCTGATGCGGCGTAGGGGTGAATGAACT
JMFN016N11+ CAGCATCGGCCAGTGCCGCCACTTCACTGGCAGCTGATGCGGCGTAGGGGTGAATGAACT
rJMFF013D10- CAGCATCGGCCAGTGCCGCCACTTCACTGGCAGCTGATGCGGCGTAGGGGTGAATGAACT
JMFN008B10+ CAGCATCGGCCAGTGCCGCCACTTCACTGGCAGCTGATGCGGCGTAGGGGTGAATGAACT
JMFN018I13+ CAGCATCGGCCAGTGCCGCCACTTCACTGGCAGCTGATGCGGCGTAGGGGTGAATGAACT
rJMFF032D21- CAGCATCGGCCAGTGCCGCCACTTCACTGGAAGCTGATGCGGCGTAGGGGTGAATGAACT
JMFN010I08+ CAGCATCGGCCAGTGCCGCCACTTCACTGGCAGCTGATGCGGCGTAGGGGTGAATGAACT
JMFN009E11+ CAGCATCGGCCAGTGCCGCCACTTCACTGGCAGCTGATGCGGCGTAGGGGTGAATGAACT
JMFN017P09+ CAGCATCGGCCAGTGCCGCCACTTCACTGGCAGCTGATGCGGCGTAGGGGTGAATGAACT
JMFF032D21+ CAGCATCGGCCAGTGCCGCCACTTCACTGGAAGCTGATGCGGCGTAGGGGTGAATGAACT
rJMSF002N12- CAGCATCGGCCAGTGCCGCCACTTCACTGGCAGCTGATGCGGCGTAGGGGTGAATGAACT
JMFN035P06+ CAGCATCGGCCAGTGCCGCCACTTCACTGGCAGCTGATGCGGCGTAGGGGTGAATGAACT
JMFN036B15+ CAGCATCGGCCAGTGCCGCCACTTCACTGGCAGCTGATGCGGCGTAGGGGTGAATGAACT
JMFN036D02+ CAGCATCGGCCAGTGCCGCCACTTCACTGGCAGCTGATGCGGCGTAGGGGTGAATGAACT
JMFN036L20+ CAGCATCGGCCAGTGCCGCCACTTCACTGGCAGCTGATGCGGCGTAGGGGTGAATGAACT
JMFN006L24+ CAGCATCGGCCAGTGCCGCCACTTCACTGGCAGCTGATGCGGCGTAGGGGTGAATGAACT
JMFN011K09+ CAGCATCGGCCAGTGCCGCCACTTCACTGGCAGCTGATGCGGCGTAGGGGTGAATGAACT
JMFN015P02+ CAGCATCGGCCAGTGCCGCCACTTCACTGGCAGCTGATGCGGCGTAGGGGTGAATGAACT
rJMSF019E19- CAGCATCGGCCAGTGCCGCCACTTCACTGGCAGCTGATGCGGCGTAGGGGTGAATGAACT
JMFN014H15+ CAGCATCGGCCAGTGCCGCCACTTCACTGGCAGCTGATGCGGCGTAGGGGTGAATGAACT
JMFN033L16+ CAGCATCGGCCAGTGCCGCCACTTCACTGGCAGCTGATGCGGCGTAGGGGTGAATGAACT
JMFN016G22+ CAGCATCGGCCAGTGCCGCCACTTCACTGGCAGCTGATGCGGCGTAGGGGTGAATGAACT
JMFN007O07+ CAGCATCGGCCAGTGCCGCCACTTCACTGGCAGCTGATGCGGCGTAGGGGTGAATGAACT
rJMSF034P04- CAGCATCGGCCAGTGCCGCCACTTCACTGGCAGCTGATGCGGCGTAGGGGTGAATGAACT
JMFN038C14+ CAGCATCGGCCAGTGCCGCCACTTCACTGGCAGCTGATGCGGCGTAGGGGTGAATGAACT
JMFN019N23+ CAGCATCGGCCAGTGCCGCCACTTCACTGGCAGCTGATGCGGCGTAGGGGTGAATGAACT
                      ____________________________________________________________
consensus CAGCATCGGCCAGTGCCGCCACTTCACTGGCAGCTGATGCGGCGTAGGGGTGAATGAACT
 
. : . : . : . : . : . :
rJMFF050I13- GGGCGGCGGTCAGGCCGCCAAG-CCCGAGCCCGATGATCACACCCTTGGTGCTCCTCATT
JMFN025C23+ GGGCGGCGGTCAGGCCGCCAAG-CCCGAGCCCGATGATCACACCCTTGGTGCTCCTCATT
JMFN016N11+ GGGCGGCGGTCAGGCCGCCAAG-CCCGAGCCCGATGATCACACCCTTGGTGCTCCTCATT
rJMFF013D10- GGGCGGCGGTCAGGCCGCCAAG-CCCGAGCCCGATGATCACACCCTTGGTGCTCCTCATT
JMFN008B10+ GGGCGGCGGTCAGGCCGCCAAG-CCCGAGCCCGATGATCACACCCTTGGTGCTCCTCATT
JMFN018I13+ GGGCGGCGGTCAGGCCGCCAAG-CCCGAGCCCGATGATCACACCCTTGGTGCTCCTCATT
rJMFF032D21- GGGCGGCGGTCAGGCCGCCAAG-CCCGAGCCCGATGATCACACCCTTGGTGCTCCTCATT
JMFN010I08+ GGGCGGCGGTCAGGCCGCCAAG-CCCGAGCCCGATGATCACACCCTTGGTGCTCCTCATT
JMFN009E11+ GGGCGGCGGTCAGGCCGCCAAG-CCCGAGCCCGATGATCACACCCTTGGTGCTCCTCATT
JMFN017P09+ GGGCGGCGGTCAGGCCGCCAAG-CCCGAGCCCGATGATCACACCCTTGGTGCTCCTCATT
JMFF032D21+ GGGCGGCGGTCAGGCCGCCAAGCCCCGAGCCCGATGATCACACCCTTGGTGCTCCTCATT
rJMSF002N12- GGGCGGCGGTCAGGCCGCCAAG-CCCGAGCCCGATGATCACACCCTTGGTGCTCCTCATT
JMFN035P06+ GGGCGGCGGTCAGGCCGCCAAG-CCCGAGCCCGATGATCACACCCTTGGTGCTCCTCATT
JMFN036B15+ GGGCGGCGGTCAGGCCGCCAAG-CCCGAGCCCGATGATCACACCCTTGGTGCTCCTCATT
JMFN036D02+ GGGCGGCGGTCAGGCGGCCAAG-CCCGAGCCCGATGATCACACCCTTGGTGCTCCTCATT
JMFN036L20+ GGGCGGCGGTCAGGCCGCCAAG-CCCGAGCCCGATGATCACACCCTTGGTGCTCCTCATT
JMFN006L24+ GGGCGGCGGTCAGGCCGCCAAG-CCCGAGCCCGATGATCACACCCTTGGTGCTCCTCATT
JMFN011K09+ GGGCGGCGGTCAGGCCGCCAAG-CCCGAGCCCGATGATCACACCCTTGGTGCTCCTCATT
JMFN015P02+ GGGCGGCGGTCAGGCCGCCAAG-CCCGAGCCCGATGATCACACCCTTGGTGCTCCTCATT
rJMSF019E19- GGGCGGCGGTCAGGCCGCCAAG-CCCGAGCCCGATGATCACACCCTTGGTGCTCCTCATT
JMFN014H15+ GGGCGGCGGTCAGGCCGCCAAG-CCCGAGCCCGATGATCACACCCTTGGTGCTCCTCATT
JMFN033L16+ GGGCGGCGGTCAGGCCGCCAAG-CCCGAGCCCGATGATCACACCCTTGGTGCTCCTCATT
JMFN016G22+ GGGCGGCGGTCAGGCCGCCAAG-CCCGAGCCCGATGATCACACCCTTGGTGCTCCTCATT
JMFN007O07+ GGGCGGCGGTCAGGCCGCCAAG-CCCGAGCCCGATGATCACACCCTTGGTGCTCCTCATT
rJMSF034P04- GGGCGGCGGTCAGGCCGCCAAG-CCCGAGCCCGATGATCACACCCTTGGTGCTCCTCATT
JMSF034P04+ CCGCCAAG-CCCGAGCCCGATGATCACACCCTTGGTGCTCCTCATT
JMFF013D10+ CCTCATT
JMFN038C14+ GGGCGGCGGTCAGGCCGCCAAG-CCCGAGCCCGATGATCACACCCTTGGTGCTCCTCATT
JMFN019N23+ GGGCGGCGGTCAGGCCGCCAAG-CCCGAGCCCGATGATCACACCCTTGGTGCTCCTCATT
                      ____________________________________________________________
consensus GGGCGGCGGTCAGGCCGCCAAG-CCCGAGCCCGATGATCACACCCTTGGTGCTCCTCATT
 
. : . : . : . : . : . :
rJMFF050I13- TTGTTGATCTGGTTCAGTGCAGGCTGGAGGATGTTGAAGAGCACCCATGCTATGGCTGGG
JMFN025C23+ TTGTTGATCTGGTTCAGTGCAGGCTGGAGGATGTTGAAGAGCACCCATGCTATGGCTGGG
JMFN016N11+ TTGTTGATCTGGTTCAGTGCAGGCTGGAGGATGTTGAAGAGCACCCATGCTATGGCTGGG
rJMFF013D10- TTGTTGATCTGGTTCAGTGCAGGCTGGAGGATGTTGAAGAGCACCCATGCTATGGCTGGG
JMFN008B10+ TTGTTGATCTGGTTCAGTGCAGGCTGGAGGATGTTGAAGAGCACCCATGCTATGGCTGGG
JMFN018I13+ TTGTTGATCTGGTTCAGTGCAGGCTGGAGGATGTTGAAGAGCACCCATGCTATGGCTGGG
rJMFF032D21- TTGTTGATCTGGTTCAGTGCAGGCTGGAGGATGTTGAAGAGCACCCATGCTATGGCTGGG
JMFN010I08+ TTGTTGATCTGGTTCAGTGCAGGCTGGAGGATGTTGAAGAGCACCCATGCTATGGCTGGG
JMFN009E11+ TTGTTGATCTGGTTCAGTGCAGGCTGGAGGATGTTGAAGAGCACCCATGCTATGGCTGGG
JMFN017P09+ TTGTTGATCTGGTTCAGTGCAGGCTGGAGGATGTTGAAGAGCACCCATGCTATGGCTGGG
JMFF032D21+ TTGTTGATCTGGTTCAGTGCAGGCTGGAGGATGTTGAAGAGCACCCATGCTATGGCTGGG
rJMSF002N12- TTGTTGATCTGGTTCAGTGCAGGCTGGAGGATGTTGAAGAGCACCCATGCTATGGCTGGG
JMFN035P06+ TTGTTGATCTGGTTCAGTGCAGGCTGGAGGATGTTGAAGAGCACCCATGCTATGGCTGGG
JMFN036B15+ TTGTTGATCTGGTTCAGTGCAGGCTGGAGGATGTTGAAGAGCACCCATGCTATGGCTGGG
JMFN036D02+ TTGTTGATCTGGTTCAGTGCAGGCTGGAGGATGTTGAAGAGCCCCCATGCTATGGCTGGG
JMFN036L20+ TTGTTGATCTGGTTCAGTGCAGGCTGGAGGATGTTGAAGAGCACCCATGCTATGGCTGGG
JMFN006L24+ TTGTTGATCTGGTTCAGTGCAGGCTGGAGGATGTTGAAGAGCACCCATGCTATGGCTGGG
JMFN011K09+ TTGTTGATCTGGTTCAGTGCAGGCTGGAGGATGTTGAAGAGCACCCATGCTATGGCTGGG
JMFN015P02+ TTGTTGATCTGGTTCAGTGCAGGCTGGAGGATGTTGAAGAGCACCCATGCTATGGCTGGG
rJMSF019E19- TTGTTGATCTGGTTCAGTGCAGGCTGGAGGATGTTGAAGAGCACCCATGCTATGGCTGGG
JMFN014H15+ TTGTTGATCTGGTTCAGTGCAGGCTGGAGGATGTTGAAGAGCACCCATGCTATGGCTGGG
JMFN033L16+ TTGTTGATCTGGTTCAGTGCAGGCTGGAGGATGTTGAAGAGCACCCATGCTATGGCTGGG
JMFN016G22+ TTGTTGATCTGGTTCAGTGCAGGCTGGAGGATGTTGAAGAGCACCCATGCTATGGCTGGG
JMFN007O07+ TTGTTGATCTGGTTCAGTGCAGGCTGGAGGATGTTGAAGAGCACCCATGCTATGGCTGGG
rJMSF034P04- TTGTTGATCTGGTTCAGTGCAGGCTGGAGGATGTTGAAGAGCACCCATGCTATGGCTGGG
JMSF034P04+ TTGTTGATCTGGTTCAGTGCAGGCTGGAGGATGTTGAAGAGCACCCATGCTATGGCTGGG
JMFF013D10+ TTGTTGATCTGGTTCAGTGCAGGCTGGAGGATGTTGAAGAGCACCCATGCTATGGCTGGG
JMFN038C14+ TTGTTGATCTGGTTCAGTGCAGGCTGGAGGATGTTGAAGAGCACCCATGCTATGGCTGGG
JMFN019N23+ TTGTTGATATGGTTCAGTGCAGGCTGGAGGATGTTGAAGAGCACCCATGCTATGGCTGGG
                      ____________________________________________________________
consensus TTGTTGATCTGGTTCAGTGCAGGCTGGAGGATGTTGAAGAGCACCCATGCTATGGCTGGG
 
. : . : . : . : . : . :
rJMFF050I13- ATGATGGGCAGCAAGAGTGCCAGCCCACGGTTGTCTCCATCGGCAGCTATCTCCGCTATC
JMFN025C23+ ATGATGGGCAGCAAGAGTGCCAGCCCACGGTTGTCTCCATCGGCAGCTATCTCCGCTATC
JMFN016N11+ ATGATGGGCAGCAAGAGTGCCAGCCCACGGTTGTCTCCATCGGCAGCTATCTCCGCTATC
rJMFF013D10- ATGATGGGCAGCAAGAGTGCCAGCCCACGGTTGTCTCCATCGGCAGCTATCTCCGCTATC
JMFN008B10+ ATGATGGGCAGCAAGAGTGCCAGCCCACGGTTGTCTCCATCGGCAGCTATCTCCGCTATC
JMFN018I13+ ATGATGGGCAGCAAGAGTGCCAGCCCACGGTTGTCTCCATCGGCAGCTATCTCCGCTATC
rJMFF032D21- ATGATGGGCAGCAAGAGTGCCAGCCCACGGTTGTCTCCATCGGCAGCTATCTCCGCTATC
JMFN010I08+ ATGATGGGCAGCAAGAGTGCCAGCCCACGGTTGTCTCCATCGGCAGCTATCTCCGCTATC
JMFN009E11+ ATGATGGGCAGCAAGAGTGCCAGCCCACGGTTGTCTCCATCGGCAGCTATCTCCGCTATC
JMFN017P09+ ATGATGGGCAGCAAGAGTGCCAGCCCACGGTTGTCTCCATCGGCAGCTATCTCCGCTATC
JMFF032D21+ ATGATGGGCAGCAAGAGTGCCAGCCCACGGTTGTCTCCATCGGCAGCTATCTCCGCTATC
rJMSF002N12- ATGATGGGCAGCAAGAGTGCCAGCCCACGGTTGTCTCCATCGGCAGCTATCTCCGCTATC
JMFN035P06+ ATGATGGGCAGCAAGAGTGCCAGCCCACGGTTGTCTCCATCGGCAGCTATCTCCGCTATC
JMFN036B15+ ATGATGGGCAGCAAGAGTGCCAGCCCACGGTTGTCTCCATCGGCAGCTATCTCCGCTATC
JMFN036D02+ ATGATGGGCAGCAAGAGTGCCAGCCCACGGTTGTCTCCATCGGCAGCTATCTCCGCTATC
JMFN036L20+ ATGATGGGCAGCAAGAGTGCCAGCCCACGGTTGTCTCCATCGGCAGCTATCTCCGCTATC
JMFN006L24+ ATGATGGGCAGCAAGAGTGCCAGCCCACGGTTGTCTCCATCGGCAGCTATCTCCGCTATC
JMFN011K09+ ATGATGGGCAGCAAGAGTGCCAGCCCACGGTTGTCTCCATCGGCAGCTATCTCCGCTATC
JMFN015P02+ ATGATGGGCAGCAAGAGTGCCAGCCCACGGTTGTCTCCATCGGCAGCTATCTCCGCTATC
rJMSF019E19- ATGATGGGCAGCAAGAGTGCCAGCCCACGGTTGTCTCCATCGGCAGCTATCTCCGCTATC
JMFN014H15+ ATGATGGGCAGCAAGAGTGCCAGCCCACGGTTGTCTCCATCGGCAGCTATCTCCGCTATC
JMFN033L16+ ATGATGGGCAGCAAGAGTGCCAGCCCACGGTTGTCTCCATCGGCAGCTATCTCCGCTATC
JMFN016G22+ ATGATGGGCAGCAAGAGTGCCAGCCCACGGTTGTCTCCATCGGCAGCTATCTCCGCTATC
JMFN007O07+ ATGATGGGCAGCAAGAGTGCCAGCCCACGGTTGTCTCCATCGGCAGCTATCTCCGCTATC
rJMSF034P04- ATGATGGGCAGCAAGAGTGCCAGCCCACGGTTGTCTCCATCGGCAGCTATCTCCGCTATC
JMSF034P04+ ATGATGGGCAGCAAGAGTGCCAGCCCACGGTTGTCTCCATCGGCAGCTATCTCCGCTATC
JMFF013D10+ ATGATGGGCAGCAAGAGTGCCAGCCCACGGTTGTCTCCATCGGCAGCTATCTCCGCTATC
JMFN038C14+ ATGATGGGCAGCAAGAGTGCCAGCCCACGGTTGTCTCCATCGGCAGCTATCTCCGCTATC
JMFN019N23+ ATGATGGGCAGCAAGAGTGCCAGCCCACGGTTGTCTCCATCGGCAGCTATCTCCGCTATC
                      ____________________________________________________________
consensus ATGATGGGCAGCAAGAGTGCCAGCCCACGGTTGTCTCCATCGGCAGCTATCTCCGCTATC
 
. : . : . : . : . : . :
rJMFF050I13- TGCTGGGCGGCGAAAGCCGGCTCAGACACACTCAGGGCGGAGAAGATCGCCC
JMFN025C23+ TGCTGGGCGGCGAAAGCCGGCTCAGACACACTCAGGGCGGAGAAGATCGCCCCAGCCAGG
JMFN016N11+ TGCTGGGCGGCGAAAGCCGGCTCAGACACACTCAGGGCGGAGAAGATCGCCCCAGCCAGG
rJMFF013D10- TGCTGGGCGGCGAAAGCCGGCTCAGACACACTCAGGGCGGAGAAGATCGCCCCAGCCAGG
JMFN008B10+ TGCTGGGCGGCGAAAGCCGGCTCAGACACACTCAGGGCGGAGAAGATCGCCCCAGCCAGG
JMFN018I13+ TGCTGGGCGGCGAAAGCCGGCTCAGACACACTCAGGGCGGAGAAGATCGCCCCAGCCAGG
rJMFF032D21- TGCTGGGCGGCGAAAGCCGGCTCAGACACACTCAGGGCGGAGAAGATCGCCCCAGCCAGG
JMFN010I08+ TGCTGGGCGGCGAAAGCCGGCTCAGACACACTCAGGGCGGAGAAGATCGCCCCAGCCAGG
JMFN009E11+ TGCTGGGCGGCGAAAGCCGGCTCAGACACACTCAGGGCGGAGAAGATCGCCCCAGCCAGG
JMFN017P09+ TGCTGGGCGGCGAAAGCCGGCTCAGACACACTCAGGGCGGAGAAGATCGCCCCAGCCAGG
JMFF032D21+ TGCTGGGCGGCGAAAGCCGGCTCAGACACACTCAGGGCGGAGAAGATCGCCCCAGCCAGG
rJMSF002N12- TGCTGGGCGGCGAAAGCCGGCTCAGACACACTCAGGGCGGAGAAGATCGCCCCAGCCAGG
JMFN035P06+ TGCTGGGCGGCGAAAGCCGGCTCAGACACACTCAGGGCGGAGAAGATCGCCCCAGCCAGG
JMFN036B15+ TGCTGGGCGGCGAAAGCCGGCTCAGACACACTCAGGGCGGAGAAGATCGCCCCAGCCAGG
JMFN036D02+ TGCTGGGCGGCGAAAGCCGGCTCAGACACACTCAGGGCGGAGAAGATCGCCCCAGCCAGG
JMFN036L20+ TGCTGGGCGGCGAAAGCCGGCTCAGACACACTCAGGGCGGAGAAGATCGCCCCAGCCAGG
JMFN006L24+ TGCTGGGCGGCGAAAGCCGGCTCAGACACACTCAGGGCGGAGAAGATCGCCCCAGCCAGG
JMFN011K09+ TGCTGGGCGGCGAAAGCCGGCTCAGACACACTCAGGGCGGAGAAGATCGCCCCAGCCAGG
JMFN015P02+ TGCTGGGCGGCGAAAGCCGGCTCAGACACACTCAGGGCGGAGAAGATCGCCCCAGCCAGG
rJMSF019E19- TGCTGGGCGGCGAAAGCCGGCTCAGACACACTCAGGGCGGAGAAGATCGCCCCAGCCAGG
JMFN014H15+ TGCTGGGCGGCGAAAGCCGGCTCAGACACACTCAGGGCGGAGAAGATCGCCCCAGCCAGG
JMFN033L16+ TGCTGGGCGGCGAAAGCCGGCTCAGACACACTCAGGGCGGAGAAGATCGCCCCAGCCAGG
JMFN016G22+ TGCTGGGCGGCGAAAGCCGGCTCAGACACACTCAGGGCGGAGAAGATCGCCCCAGCCAGG
JMFN007O07+ TGCTGGGCGGCGAAAGCCGGCTCAGACACACTCAGGGCGGAGAAGATCGCCCCAGCCAGG
JMSF019E19+ CGGAGAAGATCGCCCCAGCCAGG
rJMSF034P04- TGCTGGGCGGCGAAAGCCGGCTCAGACACACTCAGGGCGGAGAAGATCGCCCCAGCCAGG
JMSF034P04+ TGCTGGGCGGCGAAAGCCGGCTCAGACACACTCAGGGCGGAGAAGATCGCCCCAGCCAGG
JMFF013D10+ TGCTGGGCGGCGAAAGCCGGCTCAGACACACTCAGGGCGGAGAAGATCGCCCCAGCCAGG
JMFN038C14+ TGCTGGGCGGCGAAAGCCGGCTCAGACACACTCAGGGCGGAGAAGATCGCCCCAGCCAGG
JMFN019N23+ TGCTGGGCGGCGAAAGCCGGCTCAGACACACTCAGGGCGGAGAAGATCGCCCCAGCCAGG
                      ____________________________________________________________
consensus TGCTGGGCGGCGAAAGCCGGCTCAGACACACTCAGGGCGGAGAAGATCGCCCCAGCCAGG
 
. : . : . : . : . : . :
JMFN025C23+ GCTGTTCCGGTGAGGGCAGATGAAACTACAGACTTGTCTGTGTTGCAGGCTGAGAGTCCC
JMFN016N11+ GCTGTTCCGGTGAGGGCAGATGAAACTACAGACTTGTCTGTGTTGCAGGCTGAGAGTCCC
rJMFF013D10- GCTGTTCCGGTGAGGGCAGATGAAACTACAGACTTGTCTGTGTTGCAGGCTGAGAGTCCC
JMFN008B10+ GCTGTTCCGGTGAGGGCAGATGAAACTACAGACTTGTCTGTGTTGCAGGCTGAGAGTCCC
JMFN018I13+ GCTGTTCCGGTGAGGGCAGATGAAACTACAGACTTGTCTGTGTTGCAGGCTGAGAGTCCC
rJMFF032D21- GCTGTTCCGGTGAGGGCAGATGAAACTACAGACTTGTCTGTGTTGCAGGCTGAGAGTCCC
JMFN010I08+ GCTGTTCCGGTGAGGGCAGATGAAACTACAGACTTGTCTGTGTTGCAGGCTGAGAGTCCC
JMFN009E11+ GCTGTTCCGGTGAGGGCAGATGAAACTACAGACTTGTCTGTGTTGCAGGCTGAGAGTCCC
JMFN017P09+ GCTGTTCCGGTGAGGGCAGATGAAACTACAGACTTGTCTGTGTTGCAGGCTGAGAGTCCC
JMFF032D21+ GCTGTTCCGGTGAGGGCAGATGAAACTACAGACTTGTCTGTGTTGCAGGCTGAGAGTCCC
rJMSF002N12- GCTGTTCCGGTGAGGGCAGATGAAACTACAGACTTGTCTGTGTTGCAGGCTGAGAGTCCC
JMFN035P06+ GCTGTTCCGGTGAGGGCAGATGAAACTACAGACTTGTCTGTGTTGCAGGCTGAGAGTCCC
JMFN036B15+ GCTGTTCCGGTGAGGGCAGATGAAACTACAGACTTGTCTGTGTTGCAGGCTGAGAGTCCC
JMFN036D02+ GCTGTTCCGGTGAGGGCAGATGAAACTACAGACTTGTCTGTGTTGCAGGCTGAGAGTCCC
JMFN036L20+ GCTGTTCCGGTGAGGGCAGATGAAACTACAGACTTGTCTGTGTTGCAGGCTGAGAGTCCC
JMFN006L24+ GCTGTTCCGGTGAGGGCAGATGAAACTACAGACTTGTCTGTGTTGCAGGCTGAGAGTCCC
JMFN011K09+ GCTGTTCCGGTGAGGGCAGATGAAACTACAGACTTGTCTGTGTTGCAGGCTGAGAGTCCC
JMFN015P02+ GCTGTTCCGGTGAGGGCAGATGAAACTACAGACTTGTCTGTGTTGCAGGCTGAGAGTCCC
rJMSF019E19- GCTGTTCCGGTGAGGGCAGATGAAACTACAGACTTGTCTGTGTTGCAGGCTGAGAGTCCC
JMFN014H15+ GCTGTTCCGGTGAGGGCAGATGAAACTACAGACTTGTCTGTGTTGCAGGCTGAGAGTCCC
JMFN033L16+ GCTGTTCCGGTGAGGGCAGATGAAACTACAGACTTGTCTGTGTTGCAGGCTGAGAGTCCC
JMFN016G22+ GCTGTTCCGGTGAGGGCAGATGAAACTACAGACTTGTCTGTGTTGCAGGCTGAGAGTCCC
JMFN007O07+ GCTGTTCCGGTGAGGGCAGATGAAACTACAGACTTGTCTGTGTTGCAGGCTGAGAGTCCC
JMSF019E19+ GCTGTTCCGGTGAGGGCAGATGAAACTACAGACTTGTCTGTGTTGCAGGCTGAGAGTCCC
rJMSF034P04- GCTGTTCCGGTGAGGGCAGATGAAACTACAGACTTGTCTGTGTTGCAGGCTGAGAGTCCC
JMSF034P04+ GCTGTTCCGGTGAGGGCAGATGAAACTACAGACTTGTCTGTGTTGCAGGCTGAGAGTCCC
JMSF002N12+ GCTGTTCCGGTGAGGGCAGATGAAACTACAGACTTGTCTGTGTTGCAGGCTGAGAGTCCC
JMFF013D10+ GCTGTTCCGGTGAGGGCAGATGAAACTACAGACTTGTCTGTGTTGCAGGCTGAGAGTCCC
JMFN038C14+ GCTGTTCCGGTGAGGGCAGATGAAACTACAGACTTGTCTGTGTTGCAGGCTGAGAGTCCC
JMFN019N23+ GCTGTTCCGGTGAGGGCAGATGAAACTACAGACTTGTCTGTGTTGCAGGCTGAGAGTCCC
JMFF050I13+ TGTGTTGCAGGCTGAGAGTCCC
                      ____________________________________________________________
consensus GCTGTTCCGGTGAGGGCAGATGAAACTACAGACTTGTCTGTGTTGCAGGCTGAGAGTCCC
 
. : . : . : . : . : . :
JMFN025C23+ TTGGGAAGGTTTTTC-ATGGAGAGAAGTGAGATGATGGG-TTTTGGCTTGACAGGGTTAA
JMFN016N11+ TTGGGAAGGTTTTTC-ATGGAGAGAAGTGAGATGATGGG-TTTTGGCTTGACAGGGTTAA
rJMFF013D10- TTGGGAAGGTTTTTC-ATGGAGAGAAGTGAGATGATGGG-TTTTGGCTTGACAGGGTTAA
JMFN008B10+ TTGGGAAGGTTTTTC-ATGGAGAGAAGTGAGATGATGGG-TTTTGGCTTGACAGGGTTAA
JMFN018I13+ TTGGGAAGGTTTTTC-ATGGAGAGAAGTGAGATGATGGG-TTTTGGCTTGACAGGGTTAA
rJMFF032D21- TTGGGAAGGTTTTTC-ATGGAGAGAAGTGAGATGATGGG-TTTTGGCTTGACAGGGTTAA
JMFN010I08+ TTGGGAAGGTTTTTC-ATGGAGAGAAGTGAGATGATGGG-TTTTGGCTTGACAGGGTTAA
JMFN009E11+ TTGGGAAGGTTTTTC-ATGGAGAGAAGTGAGATGATGGG-TTTTGGCTTGACAGGGTTAA
JMFN017P09+ TTGGGAAGGTTTTTC-ATGGAGAGAAGTGAGATGATGGG-TTTTGGCTTGACAGGGTTAA
JMFF032D21+ TTGGGAAGGTTTTTC-ATGGAGAGAAGTGAGATGATGGG-TTTTGGCTTGACAGGGTTAA
rJMSF002N12- TTGGGAAGGTTTTTC-ATGGAGAGAAGTGAGATGATGGG-TTTTGGCTTGACAGGGTTAA
JMFN035P06+ TTGGGAAGGTTTTTC-ATGGAGAGAAGTGAGATGATGGG-TTTTGGCTTGACAGGGTTAA
JMFN036B15+ TTGGGAAGGTTTTTC-ATGGAGAGAAGTGAGATGATGGG-TTTTGGCTTGACAGGGTTAA
JMFN036D02+ TTGGGAAGGTTTTTC-ATGGAGAGAAGTGAGATGACGCGCTTTTGGCTTGACAGGGTTAA
JMFN036L20+ TTGGGAAGGTTTTTC-ATGGAGAGAAGTGAGATGAT-CC-CCTTGGCTTGACAGGGTTAA
JMFN006L24+ TTGGGAAGGTTTTTC-ATGGAGAGAAGTGAGATGATGGG-TTTTGGCTTGACAGGGTTAA
JMFN011K09+ TTGGGAAGGTTTTTCAATGGAGAGAAGTGAGATGATGGG-TTTTGGCTTGACAGGGTTAA
JMFN015P02+ TTGGGAAGGTTTTTC-ATGGAGAGAAGTGAGATGATGGG-TTTTGGCTTGACAGGGTTAA
rJMSF019E19- TTGGGAAGGTTTTTC-ATGGAGAGAAGTGAGATGATGGG-TTTTGGCTTGACAGGGTTAA
JMFN014H15+ TTGGGAAGGTTTTTC-ATGGAGAGAAGTGAGATGATGGG-TTTTGGCTTGACAGGGTTAA
JMFN033L16+ TTGGGAAGGTTTTTC-ATGGAGAGAAGTGAGATGATGGG-TTTTGGCTTGACAGGGTTAA
JMFN016G22+ TTGGGAAGGTTTTTC-ATGGAGAGAAGTGAGATGATGGG-TTTTGGCTTGACAGGGTTAA
JMFN007O07+ TTGGGAAGGTTTTTC-ATGGAGAGAAGTGAGATGATGGG-TTTTGGCTTGACAGGGTTAA
JMSF019E19+ TTGGGAAGGTTTTTC-ATGGAGAGAAGTGAGATGATGGG-TTTTGGCTTGACAGGGTTAA
rJMSF034P04- TTGGGAAGGTTTTTC-ATGGAGAGAAGTGAGATGATGGG-TTTTGGCTTGACAGGGTTAA
JMSF034P04+ TTGGGAAGGTTTTTC-ATGGAGAGAAGTGAGATGATGGG-TTTTGGCTTGACAGGGTTAA
JMSF002N12+ TTGGGAAGGTTTTTC-ATGGAGAGAAGTGAGATGATGGG-TTTTGGCTTGACAGGGTTAA
JMFF013D10+ TTGGGAAGGTTTTTC-ATGGAGAGAAGTGAGATGATGGG-TTTTGGCTTGACAGGGTTAA
JMFN038C14+ TTGGGAAGGTTTTTC-ATGGAGAGAAGTGAGATGATGGG-TTTTGGCTTGACAGGGTTAA
JMFN019N23+ TTGGGAAGGTTTTTC-ATGGAGAGAAGTGAGATGATGGG-TTTTGGCTTGACAGGGTTAA
JMFF050I13+ TGGGGAAGGTTTTTC-ATGGAGAGAAGTGAGATGATGGG-TTTTGGCTTGACAGGGTTAA
                      ____________________________________________________________
consensus TTGGGAAGGTTTTTC-ATGGAGAGAAGTGAGATGATGGG-TTTTGGCTTGACAGGGTTAA
 
. : . : . : . : . : . :
JMFN025C23+ TGGACGCTTTGGGTGTGGTTAAGCTCT
JMFN016N11+ TGGACGCTTTG
rJMFF013D10- TGGACGCTTTGGGTGTGGTTAAGCTCTTGGCATTAAG
JMFN008B10+ TGGACGCTTTGGGTGTGGTTAAGCTCTTGGCATTAAGCATG
JMFN018I13+ TGGACGCTTTGGGTGTGGTTAAGCTCTTGGCATTAAGCATGGCGGTTGTAGCTATGGTGG
rJMFF032D21- TGGACGCTTTGGGTGTGGTTAAGCTCTTGGCATTAAGCATGGCGGTTGTAGCTATGGTGG
JMFN010I08+ TGGACGCTTTGGGTGTGGTTAAGCTCTTGGCATTAAGCATGGCGGTTGTAGCTATGGTGG
JMFN009E11+ TGGACGCTTTGGGTGTGGTTAAGCTCTTGGCATTAAGCATGGCGGTTGTAGCTATGGTGG
JMFN017P09+ TGGACGCTTTGGGTGTGGTTAAGCTCTTGGCATTAAGCATGGCGGTTGTAGCTATGGTGG
JMFF032D21+ TGGACGCTTTGGGTGTGGTTAAGCTCTTGGCATTAAGCATGGCGGTTGTAGCTATGGTGG
rJMSF002N12- TGGACGCTTTGGGTGTGGTTAAGCTCTTGGCATTAAGCATGGCGGTTGTAGCTATGGTGG
JMFN035P06+ TGGACGCTTTGGGTGTGGTTAAGCTCTTGGCATTAAGCATGGCGGTTGTAGCTATGGTGG
JMFN036B15+ TGGACGCTTTGGGTGTGGTTAAGCTCTTGGCATTAAGCATGGCGGTTGTAGCTATGGTGG
JMFN036D02+ TGGACGCTTTGGGTGTGGTTAAGCTCTTGGCATTAAGCATGGCGGTTGTAGCTATGGTGG
JMFN036L20+ TGGACGCTTTGGGTGTGGTTAAGCTCTTGGCATTAAGCATGGCGGTTGTAGCTATGGTGG
JMFN006L24+ TGGACGCTTTGGGTGTGGTTAAGCTCTTGGCATTAAGCATGGCGGTTGTAGCTATGGTGG
JMFN011K09+ TGGACGCTTTGGGTGTGGTTAAGCTCTTGGCATTAAGCATGGCGGTTGTAGCTATGGTGG
JMFN015P02+ TGGACGCTTTGGGTGTGGTTAAGCTCTTGGCATTAAGCATGGCGGTTGTAGCTATGGTGG
rJMSF019E19- TGGACGCTTTGGGTGTGGTTAAGCTCTTGGCATTAAGCATGGCGGTTGTAGCTATGGTGG
JMFN014H15+ TGGACGCTTTGGGTGTGGTTAAGCTCTTGGCATTAAGCATGGCGGTTGTAGCTATGGTGG
JMFN033L16+ TGGACGCTTTGGGTGTGGTTAAGCTCTTGGCATTAAGCATGGCGGTTGTAGCTATGGTGG
JMFN016G22+ TGGACGCTTTGGGTGTGGTTAAGCTCTTGGCATTAAGCATGGCGGTTGTAGCTATGGTGG
JMFN007O07+ TGGACGCTTTGGGTGTGGTTAAGCTCTTGGCATTAAGCATGGCGGTTGTAGCTATGGTGG
JMSF019E19+ TGGACGCTTTGGGTGTGGTTAAGCTCTTGGCATTAAGCATGGCGGTTGTAGCTATGGTGG
rJMSF034P04- TGGACGCTTTGGGTGTGGTTAAGCTCTTGGCATTAAGCATGGCGGTTGTAGCTATGGTGG
JMSF034P04+ TGGACGCTTTGGGTGTGGTTAAGCTCTTGGCATTAAGCATGGCGGTTGTAGCTATGGTGG
JMSF002N12+ TGGACGCTTTGGGTGTGGTTAAGCTCTTGGCATTAAGCATGGCGGTTGTAGCTATGGTGG
JMFF013D10+ TGGACGCTTTGGGTGTGGTTAAGCTCTTGGCATTAAGCATGGCGGTTGTAGCTATGGTGG
JMFN038C14+ TGGACGCTTTGGGTGTGGTTAAGCTCTTGGCATTAAGCATGGCGGTTGTAGCTATGGTGG
JMFN019N23+ TGGACGCTTTGGGTGTGGTTAAGCTCTTGGCATTAAGCATGGCGGTTGTAGCTATGGTGG
JMFF050I13+ TGGACGCTTTGGGTGTGGTTAAGCTCTTGGCATTAAGCATGGCGGTTGTAGCTATGGTGG
                      ____________________________________________________________
consensus TGGACGCTTTGGGTGTGGTTAAGCTCTTGGCATTAAGCATGGCGGTTGTAGCTATGGTGG
 
. : . : . : . : . : . :
JMFN018I13+ CAG
rJMFF032D21- CAGCCATTTTTGCACAAGAAACCGGT-GGGAAGCTGAAAGAAT
JMFN010I08+ CAGCCATTTTTG
JMFN009E11+ CAGCCATTTTTGCACAAGAAACCGG
JMFN017P09+ CAGCCATTTTTGCACAAG
JMFF032D21+ CAGCCATTTTTGCACAAGAAACCGGT-GGGAAGCTGAGAGAAT
rJMSF002N12- CAGCCATTTTTGCACAAGAAACCGGTGGGGAAGCTGAAAGAATGCACTGAAGTGAATACC
JMFN035P06+ CAGCCATTTTTGCACAAGAAACCGGT-GGGAAGCTGAGA
JMFN036B15+ CAGCCATTTTTGCACAAGAAACCGGT
JMFN036D02+ CAGCCA-TTTTGCACAAGAAACCG
JMFN036L20+ CAGCCATTTTTGCACAAGAAACCG
JMFN006L24+ CAGCCATTTTTGCACAAGAAACCGGT-GGGAAGCT
JMFN011K09+ CAGCCATTTTTGCACAAGAAACCGGT-GGGAAGCTGA
JMFN015P02+ CAGCCATTTTTGCACAAGAAACCGGT-GGGAAGCTGA
rJMSF019E19- CAGCCATTTTTGCACAAGAAACCGGT-GGGAAGCTGAGAGAATGCACT
JMFN014H15+ CAGCCATTTTTGCACAAGAAACCGGT-GGGAAGCTGAGAGAATGCACTGAAGTGAATACC
JMFN033L16+ CAGCCATTTTTGCACAAGAAACCGGT-GGGAAGCTGAGAGAATGCACTGAAGTGAA
JMFN016G22+ CAGCCATTTTTGCACAAGAAACCGGT-GGGAAGCTGAGAGAATGCACTGAAGTG
JMFN007O07+ CAGCCATTTTTGGACAAGAAACCGGT-GGGAAGCTGAGAGAATGCACTGAAGTGAA
JMSF019E19+ CAGCCATTTTTGCACAAGAAACCGGT-GGGAAGCTGAGAGAATGCACT
rJMSF034P04- CAGCCATTTTTGCACAAGAAACCGGT-GGGAAGCTGAAANAATGCACTGAAGTGAATACC
JMSF034P04+ CAGCCATTTTTGCACAAGAAACCGGT-GGGAAGCTGAGAGAATGCACTGAAGTGAATACC
JMSF002N12+ CAGCCATTTTTGCACAAGAAACCGGT-GGGAAGCTGAGAGAATGCACTGAAGTGAATACC
JMFF013D10+ CAGCCATTTTTGCACAAGAAACCGGT-GGGAAGCTGAGAGAATGCACTGAAGTGAATACC
JMFN038C14+ CAGCCATTTTTGCACAAGAAACCGGT-GGGAAGCTGAGAGAATGCACTGAAGTGAATACC
JMFN019N23+ CAGCCATTTTTGCACAAGAAACCGGT-GGGAAGCTGAGAGAATGCACTGAAGTGAATACC
JMFF050I13+ CAGCCATTTTTGCACAAGAAACCGGT-GGGAAGCTGAGAGAATGCACTGAAGTGAATACC
                      ____________________________________________________________
consensus CAGCCATTTTTGCACAAGAAACCGGT-GGGAAGCTGAGAGAATGCACTGAAGTGAATACC
 
. : . : . : . : . : . :
rJMSF002N12- ACACCCTGTAAT
JMFN014H15+ ACACCCTG
rJMSF034P04- ACACCCTGTAATGG
JMSF034P04+ ACACCCTGTAATGGTGTTTT
JMSF002N12+ ACACCCTGTAATGGTGTTTT
JMFF013D10+ ACACCCTGTAATGGTGTTTT
JMFN038C14+ ACACCCTGTAATGGTGTTTTG
JMFN019N23+ ACACCCTGTAATGGTGTTTTGG
JMFF050I13+ ACACCCTGTAATGGTGTTTTTAGAGTTTTTTTTTTTTTTTTCAAATGCAACTATCCACTT
                      ____________________________________________________________
consensus ACACCCTGTAATGGTGTTTTGGGAGTTTTTTTTTTTTTTTTCAAATGCAACTATCCACTT
 
. : . : . : . : . : . :
JMFF050I13+ ACCAAAAATAAATTTTAAAAAACCCCAAAAGATATTGTTTTGCCAT-GAACAGGCAACAA
rJMSF036N13- TGTTTTGCCATGGAACAGGCAACAA
                      ____________________________________________________________
consensus ACCAAAAATAAATTTTAAAAAACCCCAAAAGATATTGTTTTGCCATGGAACAGGCAACAA
 
. : . : . : . : . : . :
JMFF050I13+ T-GTCTACAATTGTTCCATCTAGACTGAAACAAACAAGCCCCATTACTCTTTTATCAG-T
rJMSF036N13- TGGTCTACAATTGTTCCATTTAGACTGAAACAAACAAGCCCCATTACTCTTTTATCAG-T
rJMSF029N07- GTCTACNATTGTTCCATTTAGACTGAAACAAACAAGCCCCATTACTCTTTTATCAG-T
rJMSF042K17- TAGACTGAAACAAACAAGCCCCATTACTCTTTTATCAGCT
rJMSF015D21- TTACTCTTTTATCAG-T
                      ____________________________________________________________
consensus TGGTCTACAATTGTTCCATTTAGACTGAAACAAACAAGCCCCATTACTCTTTTATCAG-T
 
. : . : . : . : . : . :
JMFF050I13+ CCTCACAAACCACTAGGTTGGTATTCACATTTCTTACATCTATCACCCTGTGCATTCTGA
rJMSF036N13- CCTCACAAACCACTAGGTTGGTATTCACATTTCTTACATCTATCACCCTGTGCATTCTGA
rJMSF029N07- CCTCACAAACCACTAGGTTGGTATTCACATTTCTTACATCTATCACCCTGTGCATTCTGA
rJMSF042K17- CCTCACAAACCACTAGGTTGGTATTCACATTTCTTACATCTATCACCCTGTGCATTCTGA
rJMSF015D21- CCTCACAAACCACTAGGTTGGTATTCACATTTCTTACATCTATCACCCTGTGCATTCTGA
                      ____________________________________________________________
consensus CCTCACAAACCACTAGGTTGGTATTCACATTTCTTACATCTATCACCCTGTGCATTCTGA
 
. : . : . : . : . : . :
JMFF050I13+ TTTGCTCCTAAATTCTTTATGAGCAAGAAAAAAACGAAATCGGAAACAAACTTCTACTAG
rJMSF036N13- TTTGCTCCTAAATTCTTTATGAGCAAGAAAAAAACGAAATCGGAAACAAACTTCTACTAG
rJMSF029N07- TTTGCTCCTAAATTCTTTATGAGCAAGAAAAAAACGAAATCGGAAACAAACTTCTACTAG
rJMSF042K17- TTTGCTCCTAAATTCTTTATGAGCAAGAAAAAAACGAAATCGGAAACAAACTTCTACTAG
rJMSF015D21- TTTGCTCCTAAATTCTTTATGAGCAAGAAAAAAACGAAATCGGAAACAAACTTCTACTAG
                      ____________________________________________________________
consensus TTTGCTCCTAAATTCTTTATGAGCAAGAAAAAAACGAAATCGGAAACAAACTTCTACTAG
 
. : . : . : . : . : . :
JMFF050I13+ TACATATTATTCAGAGACCCTTTCCCGGATAAATCGAGGAACTATATATCACCCTTCGGA
rJMSF036N13- TACATATTATTCAGAGACCCTTTCCCGGATAAATCGAGGAACTATATATCACCCTTCGGA
rJMSF029N07- TACATATTATTCAGAGACCCTTTCCCGGATAAATCGAGGAACTATATATCACCCTTCGGA
rJMSF042K17- TACATATTATTCAGAGACCCTTTCCCGGATAAATCGAGGAACTATATATCACCCTTCGGA
rJMSF015D21- TACATATTATTCAGAGACCCTTTCCCGGATAAATCGAGGAACTATATATCACCCTTCGGA
                      ____________________________________________________________
consensus TACATATTATTCAGAGACCCTTTCCCGGATAAATCGAGGAACTATATATCACCCTTCGGA
 
. : . : . : . : . : . :
JMFF050I13+ TTTTAGCTCTGATTCTAAGCTAACTATTGTCACTTCACCCTCGTCAGACAACAAAGGAAG
rJMSF036N13- TTTTAGCTCTGATTCTAAGCTAACTATTGTCACTTCACCCTCGTCAGACAACAAAGGAAG
rJMSF029N07- TTTTAGCTCTGATTCTAAGCTAACTATTGTCACTTCACCCTCGTCAGACAACAAAGGAAG
rJMSF042K17- TTTTAGCTCTGATTCTAAGCTAACTATTGTCACTTCACCCTCGTCAGACAACAAAGGAAG
rJMSF015D21- TTTTAGCTCTGATTCTAAGCTAACTATTGTCACTTCACCCTCGTCAGACAACAAAGGAAG
                      ____________________________________________________________
consensus TTTTAGCTCTGATTCTAAGCTAACTATTGTCACTTCACCCTCGTCAGACAACAAAGGAAG
 
. : . : . : . : . : . :
JMFF050I13+ CTTACAATTGC
rJMSF036N13- CTTACACTTGCTACTCATCTTCTTCACTTTCTCGCTTGAGCATATGAAGATCCGCCTCAC
rJMSF029N07- CTTACACTTGCTACTCATCTTCTTCACTTTCTCGCTTGAGCATATGAAGATCCGCCTCAC
rJMSF042K17- CTTACACTTGCTACTCATCTTCTTCACTTTCTCGCTTGAGCATATGAAGATCCGCCTCAC
rJMSF015D21- CTTACACTTGCTACTCATCTTCTTCACTTTCTCGCTTGAGCATATGAAGATCCGCCTCAC
                      ____________________________________________________________
consensus CTTACACTTGCTACTCATCTTCTTCACTTTCTCGCTTGAGCATATGAAGATCCGCCTCAC
 
. : . : . : . : . : . :
rJMSF036N13- CATTTTGCAGAACTCCGGCCATGGGTCATCGCCTACGAGCATCATATCTCCCTCGTCATC
rJMSF029N07- CATTTTGCAGAACTCCGGCCATGGGTCATCGCCTACGAGCATCATATCTCCCTCGTCATC
rJMSF042K17- CATTTTGCAGAACTCCGGCCATGGGTCATCGCCTACGAGCATCATATCTCCCTCGTCATC
rJMSF015D21- CATTTTGCAGAACTCCGGCCATGGGTCATCGCCTACGAGCATCATATCTCCCTCGTCATC
                      ____________________________________________________________
consensus CATTTTGCAGAACTCCGGCCATGGGTCATCGCCTACGAGCATCATATCTCCCTCGTCATC
 
. : . : . : . : . : . :
rJMSF036N13- CGCGTATATGACCTCCCACTTGCTTCGAGGGCAAAGTTCGCCTTTAAGTTCAAAGATTTC
rJMSF029N07- CGCGTATATGACCTCCCACTTGCTTCGAGGGCAAAGTTCGCCTTTAAGTTCAAAGATTTC
rJMSF042K17- CGCGTATATGACCTCCCACTTGCTTCGAGGGCAAAGTTCGCCTTTAAGTTCAAAGATTTC
rJMSF015D21- CGCGTATATGACCTCCCACTTGCTTCGAGGGCAAAGTTCGCCTTTAAGTTCAAAGATTTC
                      ____________________________________________________________
consensus CGCGTATATGACCTCCCACTTGCTTCGAGGGCAAAGTTCGCCTTTAAGTTCAAAGATTTC
 
. : . : . : . : . : . :
rJMSF036N13- CTCGAGCTCGTTTAAGAGGTCATCGTAGTCCTTCATTGTTGTCAAATCAACCGCTCGTCC
rJMSF029N07- CTCGAGCTCGTTTAAGAGGTCATCGTAGTCCTTCATTGTTGTCAAATCAACCGCTCGTCC
rJMSF042K17- CTCGAGCTCGTTTAAGAGGTCATCGTAGTCCTTCATTGTTGTCAAATCAACCGCTCGTCC
rJMSF015D21- CTCGAGCTCGTTTAAGAGGTCATCGTAGTCCTTCATTGTTGTCAAATCAACCGCTCGTCC
                      ____________________________________________________________
consensus CTCGAGCTCGTTTAAGAGGTCATCGTAGTCCTTCATTGTTGTCAAATCAACCGCTCGTCC
 
. : . : . : . : . : . :
rJMSF036N13- AAAACGAGAG-------------CCTTAGTGCAAGTTCTCGAAGTAGTAACGGATGGTTT
rJMSF029N07- AAAACGAGAGCCTTCCATTTGCACCTTAGTGCAAGTTCTCGAAGTAGTAACGGATGGTTT
rJMSF042K17- AAAACGAGAGCCTTCCATTTGCACCTTAGTGCAAGTTCTCGAAGTAGTAACGGATGGTTT
rJMSF015D21- AAAACGAGAGCCTTCCATTTGCACCTTAGTGCAAGTTCTCGAAGTAGTAACGGATGGTTT
                      ____________________________________________________________
consensus AAAACGAGAGCCTTCCATTTGCACCTTAGTGCAAGTTCTCGAAGTAGTAACGGATGGTTT
 
. : . : . : . : . : . :
rJMSF036N13- GCTTAGCGTATCCTTAAGCGATGCCTCCACTAGTTTTATTTCTCGTGAGGACTTAAGATG
rJMSF029N07- GCTTAGCGTATCCTTAAGCGATGCCTCCACTAGTTTTATTTCTCGTGAGGACTTAAGATG
rJMSF042K17- GCTTAGCGTATCCTTAAGCGATGCCTCCACTAGTTTTATTTCTCGTGAGGACTTAAGATG
rJMSF015D21- GCTTAGCGTATCCTTAAGCGATGCCTCCACTAGTTTTATTTCTCGTGAGGACTTAAGATG
                      ____________________________________________________________
consensus GCTTAGCGTATCCTTAAGCGATGCCTCCACTAGTTTTATTTCTCGTGAGGACTTAAGATG
 
. : . : . : . : . : . :
rJMSF036N13- CTCTGATTTCTGAACTGCACCAACTCCATTTGCATCACAAACAGCGTTGGCATTACTTGG
rJMSF029N07- CTCTGATTTCTGAACTGCACCAACTCCATTTGCATCACAAACAGCGTTGGCATTACTTGG
rJMSF042K17- CTCTGATTTCTGAACTGCACCAACTCCATTTGCATCACAAACAGCGTTGGCATTACTTGG
rJMSF015D21- CTCTGATTTCTGAACTGCACCAACTCCATTTGCATCACAAACAGCGTTGGCATTACTTGG
                      ____________________________________________________________
consensus CTCTGATTTCTGAACTGCACCAACTCCATTTGCATCACAAACAGCGTTGGCATTACTTGG
 
. : . : . : . : . : . :
rJMSF036N13- CATGGTATTTGAACAGGGC
rJMSF029N07- CATGGTATTTGAACAGGGC
rJMSF042K17- CATGGTATTTGAACAGGGCGTTTCTTTCTCCCGACGATAATTATCAGCGTTGCTAAA
rJMSF015D21- CATGGTATTTGAACAGGGCGTTTCTTTCTCCCGACGATAATTATCAGCGTTGCTAAACTC
                      ____________________________________________________________
consensus CATGGTATTTGAACAGGGCGTTTCTTTCTCCCGACGATAATTATCAGCGTTGCTAAACTC