Previous Contig 011798:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF018I10Sequence240000947 (3)gb:AP004776_18449080.024Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC clone:P045276011798 (3)
JMFF023L06Sequence267011798 (3)
JMSF014M10Sequence110000947 (3)287011798 (3)

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF018I10+ TTTTTTTTTTTTTCCAGTTTTGAGTGTTGTATTT
rJMFF023L06+ TTTTTTTTTTTTTCCAGTTTTGAGTGTTGTATTT
rJMSF014M10+ CNTNTNTNNCCCNTTTTTTTTTTTTTCCAGTTTTGAGTGTNGTATTT
                      ____________________________________________________________
consensus CNTNTNTNNCCCNTTTTTTTTTTTTTCCAGTTTTGAGTGTTGTATTT
 
. : . : . : . : . : . :
rJMFF018I10+ GTTGGATGAAGAAGAGGAACTGAGGAAGAGACGAGAGATAATCCAGTCGGTCGGGGATGC
rJMFF023L06+ GTTGGATGAAGAAGAGGAACTGAGGAAGAGACGAGAGATAATCCAGTCGGTCGGGGATGC
rJMSF014M10+ GTTGGATGAAGAAGAGGAACTGAGGAAGAGACGAGAGATAATCCAGTCGGTCGGGGATGC
                      ____________________________________________________________
consensus GTTGGATGAAGAAGAGGAACTGAGGAAGAGACGAGAGATAATCCAGTCGGTCGGGGATGC
 
. : . : . : . : . : . :
rJMFF018I10+ ATTTTGTGTTGGAATGGTGGCTGGGAAATTCTGCCTTTCCGGCACAATAGATCATAATAA
rJMFF023L06+ ATTTTGTGTTGGAATGGTGGCTGGGAAATTCTGCCTTTCCGGCACAATAGATCATAATAA
rJMSF014M10+ ATTTTGTGTTGGAATGGTGGCTGGGAAATTCTGCCTTTCCGGCACAATAGATCATAATAA
                      ____________________________________________________________
consensus ATTTTGTGTTGGAATGGTGGCTGGGAAATTCTGCCTTTCCGGCACAATAGATCATAATAA
 
. : . : . : . : . : . :
rJMFF018I10+ ATTGCTTGTTAGGTTCAGTCATTAGATATACTAGTTCTAATCATGCTGAACGAATGCCTT
rJMFF023L06+ ATTGCTTGTTAGGTTCAGTCATTAGATATACTAGTTCTAATCATGCTGAACGAATGCCTT
rJMSF014M10+ ATTGCTTGTTAGGTTCANTCATTAGATATACTAGTTCTAATCANNCTGAACGAATGCCTT
                      ____________________________________________________________
consensus ATTGCTTGTTAGGTTCAGTCATTAGATATACTAGTTCTAATCATGCTGAACGAATGCCTT
 
. : . : . : . : . : . :
rJMFF018I10+ GTAATGAAACCGTGGAGGTTTCAAATCAATTGAATTCTGTAA
rJMFF023L06+ GTAATGANACCNTGGAGGTTTCAAATCAATTNAATTCNGTAA
rJMSF014M10+ GTNATGAAACCGTGGAGGTTTCAAATCAATTGAATTCTGTAATTTGTTGAAGACTCTCTT
                      ____________________________________________________________
consensus GTAATGAAACCGTGGAGGTTTCAAATCAATTGAATTCTGTAATTTGTTGAAGACTCTCTT