Previous Contig 011794:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF014L12Sequence463011794 (8)gb:SSMSACPDA_17225341e-29Sesamum indicum gene for stearoyl-acyl carrier protein desaturase, complete cds 783011794 (8)sp|P22243|STAD_CARTI4e-87Acyl-[acyl-carrier protein] desaturase, chloroplast precursor (EC 1.14.19.2) (St
JMSF037K11Sequence668011794 (8)gb:SSMSACPD_17225331e-81Sesame mRNA for stearoyl-acyl carrier protein desaturase, complete cds, clone CD765011794 (8)sp|P22243|STAD_CARTI5e-82Acyl-[acyl-carrier protein] desaturase, chloroplast precursor (EC 1.14.19.2) (St
JMSF041C22Sequence776011794 (8)gb:RCCSACPD_1703337e-126Ricinus communis stearoyl-acyl-carrier protein desaturase mRNA, 3' end of cds.644011794 (8)sp|P22243|STAD_CARTI3e-58Acyl-[acyl-carrier protein] desaturase, chloroplast precursor (EC 1.14.19.2) (St
JMSF048H22Sequence657011794 (8)gb:SSMSACPD_17225333e-86Sesame mRNA for stearoyl-acyl carrier protein desaturase, complete cds, clone CD749011794 (8)sp|P22243|STAD_CARTI8e-81Acyl-[acyl-carrier protein] desaturase, chloroplast precursor (EC 1.14.19.2) (St

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF014L12- GAACCTGTGACCTGTCCCACCAACAGCCCTGATCTCTCATTTCTCTCTTTCTCTCTC
                      ____________________________________________________________
consensus GAACCTGTGACCTGTCCCACCAACAGCCCTGATCTCTCATTTCTCTCTTTCTCTCTC
 
. : . : . : . : . : . :
JMSF014L12- CTGCTTCGCATTCTTCGCCATCCAGTCAGTCCTTTATTTGTTTCTCGTCTGTGTGGTGGA
JMSF037K11- GCATTCTTCGCCATCCAGTCAGTCCTTTATTTGTTTCTCGTCTGTGTGGTGGA
JMSF048H22- GTTTCTCGTCTGTGTGGTGGA
                      ____________________________________________________________
consensus CTGCTTCGCATTCTTCGCCATCCAGTCAGTCCTTTATTTGTTTCTCGTCTGTGTGGTGGA
 
. : . : . : . : . : . :
JMSF014L12- CGGCGAGCCTGAAAATCACATCCAAAATCACAAATAAAAAGACGTTCCAATCTTCACGAA
JMSF037K11- CGGCGAGCCTGAAAATCACATCCAAAATCACAAATAAAAAGACGTTCCAATCTTCACGAA
JMSF048H22- CGGCGAGCCTGAAAATCACATCCAAAATCACAAATAAAAAGACGTTCCAATCTTCACGAA
                      ____________________________________________________________
consensus CGGCGAGCCTGAAAATCACATCCAAAATCACAAATAAAAAGACGTTCCAATCTTCACGAA
 
. : . : . : . : . : . :
JMSF014L12- AACAAAGGGAGCGTGAAAAAGCATACCGAAAAATAGCGGAAAAATGGCTCTCAAGCTCAA
JMSF037K11- AACAAAGGGAGCGTGAAAAAGCATACCGAAAAATAGCGGAAAAATGGCTCTCAAGCTCAA
JMSF048H22- AACAAAGGGAGCGTGAAAAAGCATACCGAAAAATAGCGGAAAAATGGCTCTCAAGCTCAA
JMSF041C22- GGAGCGTGAAAAAGTATACCGAAAAATAGCGGAAAAATGGCTCTCAAGCTCAA
                      ____________________________________________________________
consensus AACAAAGGGAGCGTGAAAAAGCATACCGAAAAATAGCGGAAAAATGGCTCTCAAGCTCAA
 
. : . : . : . : . : . :
JMSF014L12- CTCCCTCAGCTTGCAGTCTCACAAGTGTTCTTCGTTTGCTCTTCCGCCAATGGCGAGCAG
JMSF037K11- CTCCCTCAGCTTGCAGTCTCACAAGTGTTCTTCGTTTGCTCTTCCGCCAATGGCGAGCAG
JMSF048H22- CTCCCTCAGCTTGCAGTCTCACAAGTGTTCTTCGTTTGCTCTTCCGCCAATGGCGAGCAG
JMSF041C22- CTCCCTCAGCTTGCAGTCTCACAAGTGTTCTTCGTTTGCTCTTCCGCCAATGGCGAGCAG
                      ____________________________________________________________
consensus CTCCCTCAGCTTGCAGTCTCACAAGTGTTCTTCGTTTGCTCTTCCGCCAATGGCGAGCAG
 
. : . : . : . : . : . :
JMSF014L12- CAGCCTTAGATCTCCCAAGTTCGTCATGGCTTCAACCCTCCGTTCAGGCACAAAGGAAGT
JMSF037K11- CAGCCTTAGATCTCCCAAGTTCGTCATGGCTTCAACCCTCCGTTCAGGCACAAAGGAAGT
JMSF048H22- CAGCCTTAGATCTCCCAAGTTCGTCATGGCTTCAACCCTCCGTTCAGGCACAAAGGAAGT
JMSF041C22- CAGCCTTAGATCTCCCAAGTTCGTCATGGCTTCAACCCTCCGTTCAGGCACAAAGGAAGT
                      ____________________________________________________________
consensus CAGCCTTAGATCTCCCAAGTTCGTCATGGCTTCAACCCTCCGTTCAGGCACAAAGGAAGT
 
. : . : . : . : . : . :
JMSF014L12- TGAGAACCTGAAGAAGCCTTTTACTCCACCTCGTGAGGTCCATGTTCAAGTAACACACTC
JMSF037K11- TGAGAACCTGAAGAAGCCTTTTACTCCACCTCGTGAGGTCCATGTTCAAGTAACACACTC
JMSF048H22- TGAGAACCTGAAGAAGCCTTTTACTCCACCTCGTGAGGTCCATGTTCAAGTAACACACTC
JMSF041C22- TGAGAACCTGAAGAAGCCTTTTACTCCACCTCGTGAGGTCCATGTTCAAGTAACACACTC
                      ____________________________________________________________
consensus TGAGAACCTGAAGAAGCCTTTTACTCCACCTCGTGAGGTCCATGTTCAAGTAACACACTC
 
. : . : . : . : . : . :
JMSF014L12- TATGCCACCTCAGAAAATTGAGATCTTCAAATCTATGGAGGAATGG
JMSF037K11- TATGCCACCTCAGAAAATTGAGATCTTCAAATCTATGGAGGAATGGGCTGAGGAAAATAT
JMSF048H22- TATGCCACCTCAGAAAATTGAGATCTTCAAATCTATGGAGGAATGGGCTGAGGAAAATAT
JMSF041C22- TATGCCACCTCAGAAAATTGAGATCTTCAAATCTATGGAGGAATGGGCTGAGGAAAATAT
                      ____________________________________________________________
consensus TATGCCACCTCAGAAAATTGAGATCTTCAAATCTATGGAGGAATGGGCTGAGGAAAATAT
 
. : . : . : . : . : . :
JMSF037K11- ATTAGTTCATCTGAAGCCAGTTGAAAAGTGTTGGCAACCACAGGATTTTCTACCAGACCC
JMSF048H22- ATTAGTTCATCTGAAGCCAGTTGAAAAGTGTTGGCAACCACAGGATTTTCTACCAGACCC
JMSF041C22- ATTAGTTCATCTGAAGCCAGTTGAAAAGTGTTGGCAACCACAGGATTTTCTACCAGACCC
                      ____________________________________________________________
consensus ATTAGTTCATCTGAAGCCAGTTGAAAAGTGTTGGCAACCACAGGATTTTCTACCAGACCC
 
. : . : . : . : . : . :
JMSF037K11- TGCTTCAGATGGTTTTCATGATCAGGTCAAGGAACTAAGGGAGAGGGCTAGGGAGATTCC
JMSF048H22- TGCTTCAGATGGTTTTCATGATCAGGTCAAGGAACTAAGGGAGAGGGCTAGGGAGATTCC
JMSF041C22- TGCTTCAGATGGTTTTCATGATCAGGTCAAGGAACTAAGGGAGAGGGCTAGGGAGATTCC
                      ____________________________________________________________
consensus TGCTTCAGATGGTTTTCATGATCAGGTCAAGGAACTAAGGGAGAGGGCTAGGGAGATTCC
 
. : . : . : . : . : . :
JMSF037K11- AGATGATTACTTTGTAGCTTTAGTTGGAGATATGATCACTGAAGAAGCTCTTCCAACATA
JMSF048H22- AGATGATTACTTTGTAGCTTTAGTTGGAGATATGATCACTGAAGAAGCTCTTCCAACATA
JMSF041C22- AGATGATTACTTTGTAGCTTTAGTTGGAGATATGATCACTGAAGAAGCTCTTCCAACATA
                      ____________________________________________________________
consensus AGATGATTACTTTGTAGCTTTAGTTGGAGATATGATCACTGAAGAAGCTCTTCCAACATA
 
. : . : . : . : . : . :
JMSF037K11- CCAAACAATGCTCAACACACTTGATGGTGTTAGGGATGAAACAGGTGCAAGCCCCACCTC
JMSF048H22- CCAAACAATGCTCAACACACTTGATGGTGTTAGGGATGAAACAGGTGCAAGCCCCACCTC
JMSF041C22- CCAAACAATGCTCAACACACTTGATGGTGTTAGGGATGAAACAGGTGCAAGCCCCACCTC
                      ____________________________________________________________
consensus CCAAACAATGCTCAACACACTTGATGGTGTTAGGGATGAAACAGGTGCAAGCCCCACCTC
 
. : . : . : . : . : . :
JMSF037K11- TTGGGCTGTTTGGA
JMSF048H22- TTGGGCTGTTTGGACAAGGGCTTGGACTGCTGAAG
JMSF041C22- TTGGGCTGTTTGGACAAGGGCTTGGACTGCTGAAGAGAACAGGCATGGTGACCTCCTTAA
                      ____________________________________________________________
consensus TTGGGCTGTTTGGACAAGGGCTTGGACTGCTGAAGAGAACAGGCATGGTGACCTCCTTAA
 
. : . : . : . : . : . :
JMSF041C22- TAAATATCTGTACCTTTCTGGGCGAGTTGACATGAGAGCAATTGAGAAAACAATTCAGTA
                      ____________________________________________________________
consensus TAAATATCTGTACCTTTCTGGGCGAGTTGACATGAGAGCAATTGAGAAAACAATTCAGTA
 
. : . : . : . : . : . :
JMSF041C22- CTTGATTGGGTCAGGAATGGATCCTCGGACTGAAAACAGTCCTTACCTTGGATTTATCTA
rJMSF014L12+ CTA
                      ____________________________________________________________
consensus CTTGATTGGGTCAGGAATGGATCCTCGGACTGAAAACAGTCCTTACCTTGGATTTATCTA
 
. : . : . : . : . : . :
JMSF041C22- CACATCATTCCAAGAAAGGGCAACTTTTATCTCCCATGGTAACACTGCTAGACAAGCTAA
rJMSF048H22+ TCCCATGGTNACACTGCTAGACCAGCTAA
rJMSF037K11+ TTTATCTCCCATGGTNACACTGCTAGACAAGCTAA
rJMSF014L12+ CACATCATTCCAAGAAAGGGCCACTTTTATCTCCCATGGTAACACTGCTAGACNAGCTAA
                      ____________________________________________________________
consensus CACATCATTCCAAGAAAGGGCCACTTTTATCTCCCATGGTAACACTGCTAGACAAGCTAA
 
. : . : . : . : . : . :
rJMSF048H22+ GGAGTATGGGGACATTAAACTGGCTCAAATCTGTGGCACAATCGCCGCTGATGAGAAACG
rJMSF037K11+ GGAGTATGGGGACATTAAACTGGCTCAAATCTGTGGCACAATCGCCGCTGATGAGAAACG
rJMSF014L12+ GGAGTATGGGGACATTAAACTGGCTCAAATCTGTGGCACAATCGCCGCTGATGAGAAACG
                      ____________________________________________________________
consensus GGAGTATGGGGACATTAAACTGGCTCAAATCTGTGGCACAATCGCCGCTGATGAGAAACG
 
. : . : . : . : . : . :
rJMSF048H22+ CCATGAAACTGCCTACACCAAGATAGTGGAAAAGCTTTTTGAGATCGATCCTGATGGGAC
rJMSF041C22+ TTTTTGAGATCGATCCTGATGGGAC
rJMSF037K11+ CCATGAAACTGCCTACACCAAGATAGTGGAAAAGCTTTTTGAGATCGATCCTGATGGGAC
rJMSF014L12+ CCATGAAACTGCCTACACCAAGATAGTGGAAAAGCTTTTTGAGATCGATCCTGATGGGAC
                      ____________________________________________________________
consensus CCATGAAACTGCCTACACCAAGATAGTGGAAAAGCTTTTTGAGATCGATCCTGATGGGAC
 
. : . : . : . : . : . :
rJMSF048H22+ TGTACTGGCCTTTGCAGACATGATGAAGAAGAAAATCTCTATGCCAGCACACTTGATGTT
rJMSF041C22+ TGTACTGGCCCTTGCAGACATGATGAAGAAGAAAATCTCTATGCCAGCACACTTGATGTT
rJMSF037K11+ TGTACTGGCCTTTGCAGACATGATGAAGAAGAAAATCTCTATGCCAGCACACTTGATGTT
rJMSF014L12+ TGTACTGGCCTTTGCAGACATGATGAAGAAGAAAATCTCTATGCCAGCACACTTGATGTT
                      ____________________________________________________________
consensus TGTACTGGCCTTTGCAGACATGATGAAGAAGAAAATCTCTATGCCAGCACACTTGATGTT
 
. : . : . : . : . : . :
rJMSF048H22+ TGATGGCCATGATGATAACCTCTTTGATCACTTTTCAGCAGTGGCTCAACGCCTCGGTGT
rJMSF041C22+ TGATGGCCATGATGATAACCTCTTTGATCACTTTTCAGCAGTGGCTCAACGGCTCGGTGT
rJMSF037K11+ TGATGGCCATGATGATAACCTCTTTGATCACTTTTCAGCAGTGGCTCAACGGCTCGGTGT
rJMSF014L12+ TGATGGCCATGATGATAACCTCTTTGATCACTTTTCAGCAGTGGCTCAACGGCTCGGTGT
                      ____________________________________________________________
consensus TGATGGCCATGATGATAACCTCTTTGATCACTTTTCAGCAGTGGCTCAACGGCTCGGTGT
 
. : . : . : . : . : . :
rJMSF048H22+ GTACACAGCTAGAGACTATGCAGATATTTTAGAGTTTCTCGTGGGCAGGTGGAAAGTGGG
rJMSF041C22+ GTACACAGCTAGAGACTATGCAGATATTTTAGAGTTTCTCGTGGGCAGGTGGAAAGTGGG
rJMSF037K11+ GTACACAGCTAGAGACTATGCAGATATTTTAGAGTTTCTCGTGGGCAGGTGGAAAGTGGG
rJMSF014L12+ GTACACAGCTAGAGACTATGCAGATATTTTAGAGTTTCTCGTGGGCAGGTGGAAAGTGGG
                      ____________________________________________________________
consensus GTACACAGCTAGAGACTATGCAGATATTTTAGAGTTTCTCGTGGGCAGGTGGAAAGTGGG
 
. : . : . : . : . : . :
rJMSF048H22+ AGATATTACAGGACTTTCATCTGAAGGGAGAAAAGCTCAAGACTACGTGTGTGGATTGCC
rJMSF041C22+ AGATATTACAGGACTTTCATCTGAAGGGAGAAAAGCTCAAGACTACGTGTGTGGATTGCC
rJMSF037K11+ AGATATTACAGGACTTTCATCTGAAGGGAGAAAAGCTCAAGACTACGTGTGTGGATTGCC
rJMSF014L12+ AGATATTACAGGACTTTCATCTGAATGGAGAAAAGCTCAAGACTACGTGTGTGGATTGCC
                      ____________________________________________________________
consensus AGATATTACAGGACTTTCATCTGAAGGGAGAAAAGCTCAAGACTACGTGTGTGGATTGCC
 
. : . : . : . : . : . :
rJMSF048H22+ CCCTAGAATCAGAAGACTGGAGGAGAGAGCTCAAGGTAGAGCCAAACAAGGACCCATCAT
rJMSF041C22+ CCCTAGAATCAGAAGACTGGAGGAGAGAGCTCAAGGTAGAGCCAAACAAGGACCCATCAT
rJMSF037K11+ CCCTAGAATCAGAAGACTGGAGGAGAGAGCTCAAGGTAGAGCCAAACAAGGACCCATCAT
rJMSF014L12+ CCCTAGAATCAGAAGACTGGAGGAGAGAGCTCAAGGTAGAGCCAAACAAGGACCCATCAT
                      ____________________________________________________________
consensus CCCTAGAATCAGAAGACTGGAGGAGAGAGCTCAAGGTAGAGCCAAACAAGGACCCATCAT
 
. : . : . : . : . : . :
rJMSF048H22+ CCCATTTAGCTGGATATATAATAGAGAAGTGCAGCTCTGAGTGGACTATATAATGTGGTG
rJMSF041C22+ CCCATTTAGCTGGATATATAATAGAGAAGTGCAGCTCTGAGTGGACTATATAATGTGGTG
rJMSF037K11+ CCCATTTAGCTGGATATATAATAGAGAAGTGCAGCTCTGAGTGGACTATATAATGTGGTG
rJMSF014L12+ CCCATTTAGCTGGATATATAATAGAGAAGTGCAGCTCTGAGTGGACTATATAATGTGGTG
                      ____________________________________________________________
consensus CCCATTTAGCTGGATATATAATAGAGAAGTGCAGCTCTGAGTGGACTATATAATGTGGTG
 
. : . : . : . : . : . :
rJMSF048H22+ AATTGGAATCAGGTAAGTCTCTTTCCATAAGCGCTATCAAGTGCGGGTAGTGTATTAAAA
rJMSF041C22+ AATTGGAATCAGGTAAGTCTCTTTCCATAAGCGCTATCAAGTGCGGGTAGTGTATTAAAA
rJMSF037K11+ AATTGGAATCAGGTAAGTCTCTTTCCATAAGCGCTATCAAGTGCGGGTAGTGTATTAAAA
rJMSF014L12+ AATTGGAATCAGGTAAGTCTCTTTCCATAAGCGCTATCAAGTGCGGGTAGTGTATTAAAA
                      ____________________________________________________________
consensus AATTGGAATCAGGTAAGTCTCTTTCCATAAGCGCTATCAAGTGCGGGTAGTGTATTAAAA
 
. : . : . : . : . : . :
rJMSF048H22+ CTGCAGTCTGGATCAAAATTTATATCGTTGGGTTAAGAGGTTTTGCTGGAGATATTATGC
rJMSF041C22+ CTGCAGTCTGGATCAAAATTTATATCGTTGGGTTAAGAGGTTTTGCTGGAGATATTATGC
rJMSF037K11+ CTGCAGTCTGGATCAAAATTTATATCGTTGGGTTAAGAGGTTTTGCTGGAGATATTATGC
rJMSF014L12+ CTGCAGTCTGGATCAAAATTTATATCGTTGGGTTAAGAGGTTTTGCTGGAGATATTATGC
                      ____________________________________________________________
consensus CTGCAGTCTGGATCAAAATTTATATCGTTGGGTTAAGAGGTTTTGCTGGAGATATTATGC
 
. : . : . : . : . : . :
rJMSF048H22+ TGAGTTGTAGATACAGTTATTTAATCGTGTTGTCGTTAGGTCTTCATATAGGGTCAGCTC
rJMSF041C22+ TGAGTTGTAGATACAGTTATTTAATCGTGTTGTCGTTAGGTCTTCATATAGGGTCAGCTC
rJMSF037K11+ TGAGTTGTAGATACAGTTATTTAATCGTGTTGTCGTTAGGTCTTCATATAGGGTCAGCTC
rJMSF014L12+ TGAGTTGTAGATACAGTTATTTAATCGTGTTGTCGTTAGGTCTTCATATAGGGTCAGCTC
                      ____________________________________________________________
consensus TGAGTTGTAGATACAGTTATTTAATCGTGTTGTCGTTAGGTCTTCATATAGGGTCAGCTC
 
. : . : . : . : . : . :
rJMSF048H22+ TAGTTGTCTTTTTTTCTTAAATGTCATGGTGGTGTTTATTTCTGTTCTTTGCTAGTGCTT
rJMSF041C22+ TAGTTGTCTTTTTTTCTTAAATGTCATGGTGGTGTTTATTTCTGTTCTTTGCTAGTGCTT
rJMSF037K11+ TAGTTGTCTTTTTTTCTTAAATGTCATGGTGGTGTTTATTTCTGTTCTTTGCTAGTGCTT
rJMSF014L12+ TAGTTGTCTTTTTTTCTTAAATGTCATGGTGGTGTTTATTTCTGTTCTTTGCTAGTGCTT
                      ____________________________________________________________
consensus TAGTTGTCTTTTTTTCTTAAATGTCATGGTGGTGTTTATTTCTGTTCTTTGCTAGTGCTT