Previous Contig 011792:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF014K07Sequence457011792 (2)gb:AY078010_15679792e-14Arabidopsis thaliana AT5g56980/MHM17_10 mRNA, complete cds.>gb:AF385692_1794586 732011792 (2)gb:ATU12859_15567649e-11Arabidopsis thaliana Col-0 cDNA-5-encoded protein mRNA, partial cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF014K07- GGTTAACATTTTCTCGTCTAGCTCTCTGTAAGGCCAGAGAGAAGCGACGTCGTTT
                      ____________________________________________________________
consensus GGTTAACATTTTCTCGTCTAGCTCTCTGTAAGGCCAGAGAGAAGCGACGTCGTTT
 
. : . : . : . : . : . :
JMSF014K07- TCAGTCATGATCGAATACGTATCAAGCTGGTTCACTCCCACTGTTCTCTTCTGCGTTCTG
                      ____________________________________________________________
consensus TCAGTCATGATCGAATACGTATCAAGCTGGTTCACTCCCACTGTTCTCTTCTGCGTTCTG
 
. : . : . : . : . : . :
JMSF014K07- AACCTCGTCATAGGAACCATACTCTTATCTTCCACCTTAAAGCCTCAGAAGAAGCAGCAG
                      ____________________________________________________________
consensus AACCTCGTCATAGGAACCATACTCTTATCTTCCACCTTAAAGCCTCAGAAGAAGCAGCAG
 
. : . : . : . : . : . :
JMSF014K07- CACCAACTCGGTGACGACAACTCAGTGCCACAACTCGCCCCAGTCCCCTCTCTATTCCAA
                      ____________________________________________________________
consensus CACCAACTCGGTGACGACAACTCAGTGCCACAACTCGCCCCAGTCCCCTCTCTATTCCAA
 
. : . : . : . : . : . :
JMSF014K07- CGAGTCAGGTCCTTCAACTACTCGCTCCAGCAAGAGCACCACACGCCCTCACTCTACCGT
                      ____________________________________________________________
consensus CGAGTCAGGTCCTTCAACTACTCGCTCCAGCAAGAGCACCACACGCCCTCACTCTACCGT
 
. : . : . : . : . : . :
JMSF014K07- GCACCTTCTCTGCTCCAACGCCTCGGTGCCGTCAACTTCTCGTTCTCTCGCTCGGACGAT
rJMSF014K07+ CGCTCGGACGAT
                      ____________________________________________________________
consensus GCACCTTCTCTGCTCCAACGCCTCGGTGCCGTCAACTTCTCGTTCTCTCGCTCGGACGAT
 
. : . : . : . : . : . :
JMSF014K07- TTTCCGGCGAGTACCCACCACGCAGATCCACCGGAAGACGACACCCAGACAACCCGAGCA
rJMSF014K07+ TTTCCGGCGAGTACCCACCACGCAGATCCACCGGAAGACGACACCCAGACAACCCGAGCA
                      ____________________________________________________________
consensus TTTCCGGCGAGTACCCACCACGCAGATCCACCGGAAGACGACACCCAGACAACCCGAGCA
 
. : . : . : . : . : . :
JMSF014K07- CCGTCTCTTCTGGAACGTGTCAGGTCCATTAACTTGTCGTTT
rJMSF014K07+ CCGTCTCTTCTGGAACGTGTCAGGTCCATTAACTTGTCGTTTTCCCGGTCCCGACAACCC
                      ____________________________________________________________
consensus CCGTCTCTTCTGGAACGTGTCAGGTCCATTAACTTGTCGTTTTCCCGGTCCCGACAACCC
 
. : . : . : . : . : . :
rJMSF014K07+ GACCCGTCCCCGTCTACGACCCATCTCGCGGAATCACCGGAAGCGCAGACCCAGAAGGTT
                      ____________________________________________________________
consensus GACCCGTCCCCGTCTACGACCCATCTCGCGGAATCACCGGAAGCGCAGACCCAGAAGGTT
 
. : . : . : . : . : . :
rJMSF014K07+ GAGGTAGAGAGAGATTCGGAGACCGTGATGAGTCACGACAGGAGAACCAAGTCAGCCACG
                      ____________________________________________________________
consensus GAGGTAGAGAGAGATTCGGAGACCGTGATGAGTCACGACAGGAGAACCAAGTCAGCCACG
 
. : . : . : . : . : . :
rJMSF014K07+ TGCGCCGAGATTCCGGCGAAGAAGAAGAAGAAAATGGAGAAGTCGGCGAGCGAGAAGATG
                      ____________________________________________________________
consensus TGCGCCGAGATTCCGGCGAAGAAGAAGAAGAAAATGGAGAAGTCGGCGAGCGAGAAGATG
 
. : . : . : . : . : . :
rJMSF014K07+ GAGGCGGAGGAGACGGAAGAGGAAGTGGATCGGCGGCGGCCGGCGACAGTAAGAGAGAAG
                      ____________________________________________________________
consensus GAGGCGGAGGAGACGGAAGAGGAAGTGGATCGGCGGCGGCCGGCGACAGTAAGAGAGAAG
 
. : . : . : . : . : . :
rJMSF014K07+ AAGACGACGTTCGAGGAAGAAGAAGACGATGAGGCGGTGGACGAGAAAGCCGACGACTTC
                      ____________________________________________________________
consensus AAGACGACGTTCGAGGAAGAAGAAGACGATGAGGCGGTGGACGAGAAAGCCGACGACTTC
 
. : . : . : . : . : . :
rJMSF014K07+ ATTAACAGGTTTAAGCAGCAGCTAAAGTTACAGAGGCTTGACTCCCTCCTCCGGTACAAG
                      ____________________________________________________________
consensus ATTAACAGGTTTAAGCAGCAGCTAAAGTTACAGAGGCTTGACTCCCTCCTCCGGTACAAG
 
. : . : . : . : . : . :
rJMSF014K07+ GAAACCCTGCACAGGAGAATGGGAAACTAGGGACTTGTACTTCCTGGACCAACGTGCCCA
                      ____________________________________________________________
consensus GAAACCCTGCACAGGAGAATGGGAAACTAGGGACTTGTACTTCCTGGACCAACGTGCCCA
 
. : . : . : . : . : . :
rJMSF014K07+ TGGGTGCCCAAATCTTTTGTCGTATTAGCATGGGCATTCTGGTAATTTCCGCTGCCTGCA
                      ____________________________________________________________
consensus TGGGTGCCCAAATCTTTTGTCGTATTAGCATGGGCATTCTGGTAATTTCCGCTGCCTGCA
 
. : . : . : . : . : . :
rJMSF014K07+ AAACAGTGGGAAAGCTCTGAAAATAATGGTGGTTTTGTTTTCTTTTTGTATTCTGGTCTT
                      ____________________________________________________________
consensus AAACAGTGGGAAAGCTCTGAAAATAATGGTGGTTTTGTTTTCTTTTTGTATTCTGGTCTT
 
. : . : . : . : . : . :
rJMSF014K07+ CAGTTGTAGGGTAATTATGTTTTGCTTAGGTAAATTTCTTCAGTTCAATAATATTGGCAG
                      ____________________________________________________________
consensus CAGTTGTAGGGTAATTATGTTTTGCTTAGGTAAATTTCTTCAGTTCAATAATATTGGCAG