Previous Contig 011789:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF035O06Sequence441005481 (2)752011789 (3)gb:AP004747_18443032e-13Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC clone:P040
JMSF014G16Sequence687011789 (3)gb:AP004747_18443032e-13Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC clone:P040
JMSF014H16Sequence506005481 (2)726011789 (3)gb:AP004747_18443032e-13Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC clone:P040

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF035O06+ TGAATCAATCGGCGATGGAAAGGAAATCA
                      ____________________________________________________________
consensus TGAATCAATCGGCGATGGAAAGGAAATCA
 
. : . : . : . : . : . :
rJMFF035O06+ GGAACCATGTTGCCCTGTCTGTAGGGCTAAGTGGAACTGGTTCTCTTCCATTGAAGCTTC
rJMSF014G16+ AGCTTC
rJMSF014H16+ AGCTTC
                      ____________________________________________________________
consensus GGAACCATGTTGCCCTGTCTGTAGGGCTAAGTGGAACTGGTTCTCTTCCATTGAAGCTTC
 
. : . : . : . : . : . :
rJMFF035O06+ CTGGGAGCTATCCTGGTTCCATTGGATTCAACTCCAACGGTTCTGTCTGTCTTGATGGGA
rJMSF014G16+ CTGGGAGCTATCCTGGTTCCATTGGATTCAACTCCAACGGTTCTGTCTGTCTTGATGGGA
rJMSF014H16+ CTGGGAGCTATCCTGGTTCCATTGGATTCAACTCCAACGGTTCTGTCTGTCTTGATGGGA
                      ____________________________________________________________
consensus CTGGGAGCTATCCTGGTTCCATTGGATTCAACTCCAACGGTTCTGTCTGTCTTGATGGGA
 
. : . : . : . : . : . :
rJMFF035O06+ TGATGTTAGTGAATGAATCAGAAAAGGAAGAATGGGGGACAGCAGAGAAAGTGATTGGGT
rJMSF014G16+ TGATGTTAGTGAATGAATCAGAAAAGGAAGAATGGGGGACAGCAGAGAAAGTGATTGGGT
rJMSF014H16+ TGATGTTAGTGAATGAATCAGAAAAGGAAGAATGGGGGACAGCAGAGAAAGTGATTGGGT
                      ____________________________________________________________
consensus TGATGTTAGTGAATGAATCAGAAAAGGAAGAATGGGGGACAGCAGAGAAAGTGATTGGGT
 
. : . : . : . : . : . :
rJMFF035O06+ GTGGGTACAATCCAACCCAGAAGAAGGTATTCTTCACAGTGGATTCACAGCTTATCCATG
rJMSF014G16+ GTGGGTACAATCCAACCCAGAAGAAGGTATTCTTCACAGTGGATTCACAGCTTATCCATG
rJMSF014H16+ GTGGGTACAATCCAACCCAGAAGAAGGTATTCTTCACAGTGGATTCACAGCTTATCCATG
                      ____________________________________________________________
consensus GTGGGTACAATCCAACCCAGAAGAAGGTATTCTTCACAGTGGATTCACAGCTTATCCATG
 
. : . : . : . : . : . :
rJMFF035O06+ AAATCCACTGCAAATCCGAGGAATTTGGGAACCCATTGTACCCAACTTTAGCTGCAAATG
rJMSF014G16+ AAATCCACTGCAAATCCGAGGAATTTGGGAACCCATTGTACCCAACTTTAGCTGCAAATG
rJMSF014H16+ AAATCCACTGCAAATCCGAGGAATTTGGGAACCCATTGTACCCAACTTTAGCTGCAAATG
                      ____________________________________________________________
consensus AAATCCACTGCAAATCCGAGGAATTTGGGAACCCATTGTACCCAACTTTAGCTGCAAATG
 
. : . : . : . : . : . :
rJMFF035O06+ CTGACATAATGGTTGTGGTGAATCTTGGGCAGAGTGCATTCAAATATGCAGCTGCAAATC
rJMSF014G16+ CTGACATAATGGTTGTGGTGAATCTTGGGCAGAGTGCATTCAAATATGCAGCTGCAAATC
rJMSF014H16+ CTGACATAATGGTTGTGGTGAATCTTGGGCAGAGTGCATTCAAATATGCAGCTGCAAATC
                      ____________________________________________________________
consensus CTGACATAATGGTTGTGGTGAATCTTGGGCAGAGTGCATTCAAATATGCAGCTGCAAATC
 
. : . : . : . : . : . :
rJMFF035O06+ TGCAGAGAACTCCAAACCCATGCTTCATTGGGCCTCTGGCAAGCAATTCTCCAGCAGCTA
rJMSF014G16+ TGCAGAGAACTCCAAACCCATGCTTCATTGGGCCTCTGGCAAGCAATTCTCCAGCAGCTA
rJMSF014H16+ TGCAGAGAACTCCAAACCCATGCTTCATTGGGCCTCTGGCAAGCAATTCTCCAGCAGCTA
                      ____________________________________________________________
consensus TGCAGAGAACTCCAAACCCATGCTTCATTGGGCCTCTGGCAAGCAATTCTCCAGCAGCTA
 
. : . : . : . : . : . :
rJMFF035O06+ TAGGGTATGAAGACAGCAAGGAGCTTTTCTCCATGGGGAGAATCGATTCCCAGTGGCTGA
rJMSF014G16+ TAGGGTATGAAGACAGCAAGGAGCTTTTCTCCATGGGGAGAATCGATTCCCAGTGGCTGA
rJMSF014H16+ TAGGGTATGAAGACAGCAAGGAGCTTTTCTCCATGGGGAGAATCGATTCCCAGTGGCTGA
                      ____________________________________________________________
consensus TAGGGTATGAAGACAGCAAGGAGCTTTTCTCCATGGGGAGAATCGATTCCCAGTGGCTGA
 
. : . : . : . : . : . :
rJMFF035O06+ ACAGAAGCGCAACTGCAGCAAGGAGCAATGGCAACAGTGTGAATAATCTGAAGCAGATAG
rJMSF014G16+ ACAGAAGCGCAACTGCAGCAAGGAGCAATGGCAACAGTGTGAATAATCTGAAGCAGATAG
rJMSF014H16+ ACAGAAGCGCAACTGCAGCAAGGAGCAATGGCAACAGTGTGAATAATCTGAAGCAGATAG
                      ____________________________________________________________
consensus ACAGAAGCGCAACTGCAGCAAGGAGCAATGGCAACAGTGTGAATAATCTGAAGCAGATAG
 
. : . : . : . : . : . :
rJMFF035O06+ ATTTTGATGACTTGGAATCTGAAGGGGAGCTGTTTGAAATTGTGTTGGATAGTTCAGGGA
rJMSF014G16+ ATTTTGATGACTTGGAATCTGAAGGGGAGCTGTTTGAAATTGTGTTGGATAGTTCAGGGA
rJMSF014H16+ ATTTTGATGACTTGGAATCTGAAGGGGAGCTGTTTGAAATTGTGTTGGATAGTTCAGGGA
                      ____________________________________________________________
consensus ATTTTGATGACTTGGAATCTGAAGGGGAGCTGTTTGAAATTGTGTTGGATAGTTCAGGGA
 
. : . : . : . : . : . :
rJMFF035O06+ AAAATCCCAACACTCTATAGCATCATCATCATCCTAACAAAACATCATTAGATTAGATCA
rJMSF014G16+ AAAATCCCAACACTCTATAGCATCATCATCATCCTAACAAAACATCATTAGATTAGATCA
rJMSF014H16+ AAAATCCCAACACTCTATAGCATCATCATCATCCTAACAAAACATCATTAGATTAGATCA
                      ____________________________________________________________
consensus AAAATCCCAACACTCTATAGCATCATCATCATCCTAACAAAACATCATTAGATTAGATCA
 
. : . : . : . : . : . :
rJMFF035O06+ TTTCTTTTAATCATACTTTGCTTGTGCATGTTAATTAGTTTCTTGTTTTCCCCTCTTTTC
rJMSF014G16+ TTTCTTTTAATCATACTTTGCTTGTGCATGTTAATTAGTTTCTTGTTTTCCCCTCTTTTC
rJMSF014H16+ TTTCTTTTAATCATACTTTGCTTGTGCATGTTAATTAGTTTCTTGTTTTCCCCTCTTTTC
                      ____________________________________________________________
consensus TTTCTTTTAATCATACTTTGCTTGTGCATGTTAATTAGTTTCTTGTTTTCCCCTCTTTTC
 
. : . : . : . : . : . :
rJMFF035O06+ TCT
rJMSF014G16+ TCTTGAATGAAGGCTGCAAAA
rJMSF014H16+ TCTTGAATGAAGGCTGCAAAATTTTGTGTGAATTGCCTTCCTTGTAACCAGAAAAATATT
                      ____________________________________________________________
consensus TCTTGAATGAAGGCTGCAAAATTTTGTGTGAATTGCCTTCCTTGTAACCAGAAAAATATT