Previous Contig 011788:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF014F07Sequence270005465 (5)738011788 (4)
JMSF014H09Sequence595005465 (5)gb:AY058842_15643794e-55Arabidopsis thaliana AT4g28880/F16A16_10 mRNA, complete cds.>gb:AY079031_1568144737011788 (4)gb:HSU63332_20253712e-04Human super cysteine rich protein mRNA, partial cds.
JMSF020L16Sequence621005465 (5)gb:AY058842_15643794e-60Arabidopsis thaliana AT4g28880/F16A16_10 mRNA, complete cds.>gb:AY079031_1568144426011788 (4)
JMSF052E24Sequence616005465 (5)gb:AY058842_15643794e-60Arabidopsis thaliana AT4g28880/F16A16_10 mRNA, complete cds.>gb:AY079031_1568144875011788 (4)gb:AY058842_15643797e-09Arabidopsis thaliana AT4g28880/F16A16_10 mRNA, complete cds.>gb:AY079031_1568144

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF052E24+ CAGCAGGC
                      ____________________________________________________________
consensus CAGCAGGC
 
. : . : . : . : . : . :
rJMSF052E24+ ACAAAGTAGTAGAACACAGCAACGGCCACTGCATGGAGAGAGCAGCCGAAGAGTTCCATT
                      ____________________________________________________________
consensus ACAAAGTAGTAGAACACAGCAACGGCCACTGCATGGAGAGAGCAGCCGAAGAGTTCCATT
 
. : . : . : . : . : . :
rJMSF052E24+ GGATTCAGAAAAGCATCAAGTGGGAAACAATGCTCCTTATTCTGCTGAGTTGACAAAATC
                      ____________________________________________________________
consensus GGATTCAGAAAAGCATCAAGTGGGAAACAATGCTCCTTATTCTGCTGAGTTGACAAAATC
 
. : . : . : . : . : . :
rJMSF052E24+ AAGCATTCCTACTAGTCCTGGTGCTCGTGCACAATTCAAGTTGTCAACAAATCGGAATTT
rJMSF014F07+ AATTCAAGTTGTCAACAAATCGGAATTT
rJMSF014H09+ GTCAACAAATCGGAATTT
                      ____________________________________________________________
consensus AAGCATTCCTACTAGTCCTGGTGCTCGTGCACAATTCAAGTTGTCAACAAATCGGAATTT
 
. : . : . : . : . : . :
rJMSF052E24+ GGCTTCTGGCAATCTTGAAACAGTTGACAGAAATATGCTGAGCAATGCATACATGGCATC
rJMSF014F07+ GGCTTCTGGCAATCTTGAAACAGCTGAGAGAAATATGCTGAGCAATGCATACATGGCATC
rJMSF014H09+ GGCTTCTGGCAATCTTGAAACAGTTGAGAGAAATATGCTGAGCAATGCATACATGGCATC
                      ____________________________________________________________
consensus GGCTTCTGGCAATCTTGAAACAGTTGAGAGAAATATGCTGAGCAATGCATACATGGCATC
 
. : . : . : . : . : . :
rJMSF052E24+ TACATCATTGTCTCCAGCTGGTTTTGGAAGAGCAAGTGCAACTAAACCTACTTTACCTGC
rJMSF014F07+ TACATCATCGTCTCCAGCTGGTTTTGGAAGAGCAAGTGCAACTAAACCTACTTTACCTGC
rJMSF014H09+ TACATCATTGTCTCCAGCTGGTTTTGGAAGAGCAAGTGCAACTAAACCTACTTTACCTGC
                      ____________________________________________________________
consensus TACATCATTGTCTCCAGCTGGTTTTGGAAGAGCAAGTGCAACTAAACCTACTTTACCTGC
 
. : . : . : . : . : . :
rJMSF052E24+ TGAAACGACCAATGCTGGTCATGTAAATGGTGATAATTCTGGTGCAGGCAGCTGGATTTC
rJMSF014F07+ TGAAACGACCAATGCTGGTCATGTAAATGGTGATAATTCTGGTGCAGGCAGCTGGATTTC
rJMSF014H09+ TGAAACGACCAATGCTGGTCATGTAAATGGTGATAATTCTGGTGCAGGCAGCTGGATTTC
                      ____________________________________________________________
consensus TGAAACGACCAATGCTGGTCATGTAAATGGTGATAATTCTGGTGCAGGCAGCTGGATTTC
 
. : . : . : . : . : . :
rJMSF052E24+ CTCTTTACGTCGCATTTCTTCTGCCAAGTGATAAGAGATGTTAAAGAATTGTTGCTTAAG
rJMSF020L16+ CCAAGNGATAAGAGATGTTAAAGAATTGTTGCGTAAN
rJMSF014F07+ CTCTTTACGTCGCATTTCTTCTGCCAAGTGATAAGAGATGTTAAAGAATTGTTGCTTAAG
rJMSF014H09+ CTCTTTACGTCGCATTTCTTCTGCCAAGTGATAAGAGATGTTAAAGAATTGTTGCTTAAG
                      ____________________________________________________________
consensus CTCTTTACGTCGCATTTCTTCTGCCAAGTGATAAGAGATGTTAAAGAATTGTTGCTTAAG
 
. : . : . : . : . : . :
rJMSF052E24+ TTGGGTGCAGACTTGGTATCAATTAGAATAGGACATGGAGCTATCAAAGGAAGGTTGATA
rJMSF020L16+ TTGGGTGCAGNCTTGGTNTCAATTAGAATNGGACATGGAGNNATCAAAGGAAGNNTGATA
rJMSF014F07+ TTGGGTGCAGACTTGGTATCAATTAGAATAGGACATGGAGCTATCAAAGGAAGGTTGATA
rJMSF014H09+ TTGGGTGCAGACTTGGTATCAATTAGAATAGGACATGGAGCTATCAAAGGAAGGTTGATA
                      ____________________________________________________________
consensus TTGGGTGCAGACTTGGTATCAATTAGAATAGGACATGGAGCTATCAAAGGAAGGTTGATA
 
. : . : . : . : . : . :
rJMSF052E24+ ATCCCATACTGGTTCATGGCTGCAGTCCCAACAACCCGAGATGCATCAATTGACAGCAAG
rJMSF020L16+ ATNCCATATNGGTTCATGGCNGCNGTCCCAACAANCCGNGATGCATCAATNGNCAGCAAG
rJMSF014F07+ ATCCCATACTGGTTCATGGCTGCAGTCCCAACAACCCGAGATGCATCAATTGACAGCAAG
rJMSF014H09+ ATCCCATACTGGTTCATGGCTGCAGTCCCAACAACCCGAGATGCATCAATTGACAGCAAG
                      ____________________________________________________________
consensus ATCCCATACTGGTTCATGGCTGCAGTCCCAACAACCCGAGATGCATCAATTGACAGCAAG
 
. : . : . : . : . : . :
rJMSF052E24+ CAAGGCCCGAGAGCACATTTTGCCATTCATCTTGTCAAGGCTCGGGTTAGACTTTTTCCT
rJMSF020L16+ CAAGGCCCGAGAGCACATTTNNCCANTCATNTNNTCAAGGCTCGGGTTAGNCTNTTTCCT
rJMSF014F07+ CAAGGCCCGAGAGCACATTTTGCCATTCATCTTGTCAAGGCTCGGGTTAGACTTTTTCCT
rJMSF014H09+ CAAGGCCCGAGAGCACATTTTGCCATTCATCTTGTCAAGGCTCGGGTTAGACTTTTTCCT
                      ____________________________________________________________
consensus CAAGGCCCGAGAGCACATTTTGCCATTCATCTTGTCAAGGCTCGGGTTAGACTTTTTCCT
 
. : . : . : . : . : . :
rJMSF052E24+ AGATGACTATAAACAAATTCACGTTTGCTTGCAGATCACAGAGCTTTGTTCCTGTGGTGT
rJMSF020L16+ AGATGNCTATAAACNAATTCACGNNNGNTNGCNGATCACAGAGCTTTGNTCCTGTGGTGT
rJMSF014F07+ AGATGACTATAAACAAATTCACGTTTGCTTGCAGATCACAGAGCTTTGTTCCTGTGGTGT
rJMSF014H09+ AGATGACTATAAACAAATTCACGTTTGCTTGCAGATCACAGAGCTTTGTTCCTGTGGTGT
                      ____________________________________________________________
consensus AGATGACTATAAACAAATTCACGTTTGCTTGCAGATCACAGAGCTTTGTTCCTGTGGTGT
 
. : . : . : . : . : . :
rJMSF052E24+ TGTGTACGTTGAAAGAATCAATTCCTGAAATTTAGGCTGCTTAGTTTGGTGTAAAATCAA
rJMSF020L16+ NGTGTACGTTGAAAGAATCAANTCCTGAAATTTNGGNTGCTTAGTTTGGTGTAAAATCAA
rJMSF014F07+ TGTGTACGTTGAAAGAATCAATTCCTGAAATTTAGGCTGCTTAGTTTGGTGTAAAATCAA
rJMSF014H09+ TGTGTACGTTGAAAGAATCAATTCCTGAAATTTAGGCTGCTTAGTTTGGTGTAAAATCAA
                      ____________________________________________________________
consensus TGTGTACGTTGAAAGAATCAATTCCTGAAATTTAGGCTGCTTAGTTTGGTGTAAAATCAA
 
. : . : . : . : . : . :
rJMSF052E24+ TGATATGTTTTAAGTTTTTGTTCTTTGTCAGCAGATCGTAAGTTTCCTTTGTGCATATAG
rJMSF020L16+ TGATATGTTTTAAGTTTTTGTTCTTTGTCAGCAGATCGTAAGTTTCCTTNGNGCANATAG
rJMSF014F07+ TGATATGTTTTAAGTTTTTGTTCTTTGTCAGCAGATCGTAAGTTTCCTTTGTGCATATAG
rJMSF014H09+ TGATATGTTTTAAGTTTTTGTTCTTTGTCAGCAGATCGTAAGTTTCCTTTGTGCATATAG
                      ____________________________________________________________
consensus TGATATGTTTTAAGTTTTTGTTCTTTGTCAGCAGATCGTAAGTTTCCTTTGTGCATATAG
 
. : . : . : . : . : . :
rJMSF052E24+ TGATGGTTGACTGGTTGTTTCTCTCACTCACATTTCTTCATCTGAGTTGCACATGTTGTA
rJMSF020L16+ NGANGGTTGACNGGTNGTTTCTCTCA
rJMSF014F07+ TGATGGTTGACTGGTTGTTTCTCTCACTCACATNTCTTCATCTGAGTTGCACATGTTGTA
rJMSF014H09+ TGATGGTTGACTGGTTGTTTCTCTCACTCACATTTCTTCATCTGAGTTGCACATGTTGTA
                      ____________________________________________________________
consensus TGATGGTTGACTGGTTGTTTCTCTCACTCACATTTCTTCATCTGAGTTGCACATGTTGTA
 
. : . : . : . : . : . :
rJMSF052E24+ AGT-GCTGTGTTGTTTTGTATTTTCTGC
rJMSF014F07+ AGTGGCTGTGTTGTTTTGTATTTTCTGCCATNCAAGCACCAT
rJMSF014H09+ AGT-GCTGTGTTGTTTTGTATTTTCTGCCATTCAAGCACCATTTGTATGAAAAGCACAAT
                      ____________________________________________________________
consensus AGT-GCTGTGTTGTTTTGTATTTTCTGCCATTCAAGCACCATTTGTATGAAAAGCACAAT