Previous Contig 011787:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFN030C20Sequence621011787 (4)gb:BT003692_16368914e-26Arabidopsis thaliana At1g61220 mRNA, complete cds.>gb:AK118677_1816641 Arabidops
JMSF014H03Sequence247005476 (5)pir|E86245|E862450.032hypothetical protein [imported] - Arabidopsis thaliana>gb:AE005172_890124 Arabid788011787 (4)gb:BT003692_16368912e-32Arabidopsis thaliana At1g61220 mRNA, complete cds.>gb:AK118677_1816641 Arabidops
JMSF022J22Sequence655005476 (5)pir|E86245|E862456e-66hypothetical protein [imported] - Arabidopsis thaliana>gb:AE005172_890124 Arabid798011787 (4)gb:BT003692_16368918e-35Arabidopsis thaliana At1g61220 mRNA, complete cds.>gb:AK118677_1816641 Arabidops
JMSF051N15Sequence671005476 (5)pir|E86245|E862454e-70hypothetical protein [imported] - Arabidopsis thaliana>gb:AE005172_890124 Arabid768011787 (4)gb:BT003692_16368913e-27Arabidopsis thaliana At1g61220 mRNA, complete cds.>gb:AK118677_1816641 Arabidops

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF022J22+ ACAAAGNTGCAGGTAGTTCGACAT
rJMSF014H03+ TTCGACAT
                      ____________________________________________________________
consensus ACAAAGNTGCAGGTAGTTCGACAT
 
. : . : . : . : . : . :
rJMSF022J22+ TTTTGGGAACGGAATGACATTAAGGGTGCTATCAATGCCTTGAAAAAGTTGCCTGATCAT
rJMSF051N15+ GAATGACATTAAGGGTGCTATCAATGCCNTGAAAAAGTTGCCTGATCAT
JMFN030C20- GGGTGCTATCAATGCCTTGAAAAAGTTGCCTGATCAT
rJMSF014H03+ TTTTGGGAACGGAATGACATTAAGGGTGCTATCAATGCCTTGAAAAAGTTGCCTGATCAT
                      ____________________________________________________________
consensus TTTTGGGAACGGAATGACATTAAGGGTGCTATCAATGCCTTGAAAAAGTTGCCTGATCAT
 
. : . : . : . : . : . :
rJMSF022J22+ TCTGTACAAGCAGATGTAGTCAGTGTTCTGATTGAAAGAATGGAGGTTATTACCTTAGAG
rJMSF051N15+ TCTGTACAAGCAGATGTAGTCAGTGTTCTGATTGAAAGAATGGAGGTTATTACCTTAGAG
JMFN030C20- TCTGTACAAGCAGATGTAGTCAGTGTTCTGATTGAAAGAATGGAGGTTATTACCTTAGAG
rJMSF014H03+ TCTGTACAAGCAGATGTAGTCAGTGTTCTGATTGAAAGAATGGAGGTTATTACCTTAGAG
                      ____________________________________________________________
consensus TCTGTACAAGCAGATGTAGTCAGTGTTCTGATTGAAAGAATGGAGGTTATTACCTTAGAG
 
. : . : . : . : . : . :
rJMSF022J22+ TTGTTTTCTTCTTTACTTCCTGTGCTATTGGCCTTACTAGACAGCAAGATTGAAAGACAT
rJMSF051N15+ TTGTTTTCTTCTTTACTTCCTGTGCTATTGGCCTTACTAGACAGCAAGATTGAAAGACAT
JMFN030C20- TTGTTTTCTTCTTTACTTCCTGTGCTATTGGCCTTACTAGACAGCAAGATTGAAAGACAT
rJMSF014H03+ TTGTTTTCTTCTTTACTTCCTGTGCTATTGGCCTTACTAGACAGCAAGATTGAAAGACAT
                      ____________________________________________________________
consensus TTGTTTTCTTCTTTACTTCCTGTGCTATTGGCCTTACTAGACAGCAAGATTGAAAGACAT
 
. : . : . : . : . : . :
rJMSF022J22+ GCAAATGTTTCTCTAGAGATGCTGTTGAAGCTCGTGGCAATCTTTGGTCCAGTGGTCCGA
rJMSF051N15+ GCAAATGTTTCTCTAGAGATGCTGTTGAAGCTCGTGGCAATCTTTGGTCCAGTGGTCCGA
JMFN030C20- GCAAATGTTTCTCTAGAGATGCTGTTGAAGCTCGTGGCAATCTTTGGTCCAGTGGTCCGA
rJMSF014H03+ GCAAATGTTTCTCTAGAGATGCTGTTGAAGCTCGTGGCAATCTTTGGTCCAGTGGTCCGA
                      ____________________________________________________________
consensus GCAAATGTTTCTCTAGAGATGCTGTTGAAGCTCGTGGCAATCTTTGGTCCAGTGGTCCGA
 
. : . : . : . : . : . :
rJMSF022J22+ TCAGCTGCTTCTGCACGTCCATCTGTAGGTGTTGATCTTCATGCCGAGCAGAGAATTGAG
rJMSF051N15+ TCAGCTGCTTCTGCACGTCCATCTGTAGGTGTTGATCTTCATGCCGAGCAGAGAATTGAG
JMFN030C20- TCAGCTGCTTCTGCACGTCCATCTGTAGGTGTTGATCTTCATGCCGAGCAGAGAATTGAG
rJMSF014H03+ TCAGCTGCTTCTGCACGTCCATCTGTAGGTGTTGATCTTCATGCCGAGCAGAGAATTGAG
                      ____________________________________________________________
consensus TCAGCTGCTTCTGCACGTCCATCTGTAGGTGTTGATCTTCATGCCGAGCAGAGAATTGAG
 
. : . : . : . : . : . :
rJMSF022J22+ TGCTGCAGACAGTGCTTGGCGCATCTCCAAATTATCCAACAGATTATTCCGACACTCATA
rJMSF051N15+ TGCTGCAGACAGTGCTTGGCGCATCTCCAAATTATCCAACAGATTATTCCGACACTCATA
JMFN030C20- TGCTGCAGACAGTGCTTGGCGCATCTCCAAATTATCCAACAGATTATTCCGACACTCATA
rJMSF014H03+ TGCTGCAGACAGTGCTTGGCGCATCTCCAAATTATCCAACAGATTATTCCGACACTCATA
                      ____________________________________________________________
consensus TGCTGCAGACAGTGCTTGGCGCATCTCCAAATTATCCAACAGATTATTCCGACACTCATA
 
. : . : . : . : . : . :
rJMSF022J22+ CAGAGGGGTGGTTTGGTGGCAAAATCTGCACTTCAACTAAATCTTGTTCTTCAGCAATGA
rJMSF051N15+ CAGAGGGGTGGTTTGGTGGCAAAATCTGCACTTCAACTAAATCTTGTTCTTCAGCAATGA
JMFN030C20- CAGAGGGGTGGTTTGGTGGCAAAATCTGCACTTCAACTAAATCTTGTTCTTCAGCAATGA
rJMSF014H03+ CAGAGGGGTGGTTTGGTGGCAAAATCTGCACTTCAACTAAATCTTGTTCTTCAGCAATGA
                      ____________________________________________________________
consensus CAGAGGGGTGGTTTGGTGGCAAAATCTGCACTTCAACTAAATCTTGTTCTTCAGCAATGA
 
. : . : . : . : . : . :
rJMSF022J22+ TAAGATAATCTGCACATTTTCATCTTACTACTCATCAAGGGGCACTCTTGTGTACAATCT
rJMSF051N15+ TAAGATAATCTGCACATTTTCATCTTACTACTCATCAAGGGGCACTCTTGTGTACAATCT
JMFN030C20- TAAGATAATCTGCACATTTTCATCTTACTACTCATCAAGGGGCACTCTTGTGTACAATCT
rJMSF014H03+ TAAGATAATCTGCACATTTTCATCTTACTACTCATCAAGGGGCACTCTTGTGTACAATCT
                      ____________________________________________________________
consensus TAAGATAATCTGCACATTTTCATCTTACTACTCATCAAGGGGCACTCTTGTGTACAATCT
 
. : . : . : . : . : . :
rJMSF022J22+ GGGGATATCGCAGTTTTGTCCATATGATTTCCGTCTTTTGCTGCCAATTCTCGGCCTCCT
rJMSF051N15+ GGGGATATCGCAGTTTTGTCCATATGATTTCCGTCTTTTGCTGCCAATTCTCGGCCTCCT
JMFN030C20- GGGGATATCGCAGTTTTGTCCATATGATTTCCGTCTTTTGCTGCCAATTCTCGGCCTCCT
rJMSF014H03+ GGGGATATCGCAGTTTTGTCCATATGATTTCCGTCTTTTGCTGCCAATTCTCGGCCTCCT
                      ____________________________________________________________
consensus GGGGATATCGCAGTTTTGTCCATATGATTTCCGTCTTTTGCTGCCAATTCTCGGCCTCCT
 
. : . : . : . : . : . :
rJMSF022J22+ TTCGGGTAGCCATTAAGCCGAGGCCCGAGGGGAGCATGCATGAGCGTGACCATATCCGTA
rJMSF051N15+ TTCGGGTAGCCATTAAGCCGAGGCCCGAGGGGAGCATGCATGAGCGTGACCATATCCGTA
JMFN030C20- TTCGGGTAGCCATTAAGCCGAGGCCCGAGGGGAGCATGCATGAGCGTGACCATATCCGTA
rJMSF014H03+ TTCGGGTAGCCATTAAGCCGAGGCCCGAGGGGAGCATGCATGAGCGTGACCATATCCGTA
                      ____________________________________________________________
consensus TTCGGGTAGCCATTAAGCCGAGGCCCGAGGGGAGCATGCATGAGCGTGACCATATCCGTA
 
. : . : . : . : . : . :
rJMSF022J22+ TATCACCCCAGCTTGGGGTTCGAGAAAATCCTATGTTCTTGGCTTCAGGCGTTTTTGTAG
rJMSF051N15+ TATCACCCCAGCTTGGGGTTCGAGAAAATCCTATGTTCTTGGCTTCAGGCGTTTTTGTAG
JMFN030C20- TATCACCCCAGCTTGGGGTTCGAGAAAATCCTATGTTCTTGGCT
rJMSF014H03+ TATCACCCCAGCTTGGGGTTCGAGAAAATCCTATGTTCTTGGCTTCAGGCGTTTTTGTAG
                      ____________________________________________________________
consensus TATCACCCCAGCTTGGGGTTCGAGAAAATCCTATGTTCTTGGCTTCAGGCGTTTTTGTAG
 
. : . : . : . : . : . :
rJMSF022J22+ TACCCAACAACTGATAATATGCCTTTGCAGATATTGTAGCAAGAATTTGTGCTCCAATAG
rJMSF051N15+ TACCCAACAACTGATAATATGCCTTTGCAGATATTGTAGCAAGAATTTGTGCTCCAATAG
rJMSF014H03+ TACCCAACAACTGATAATATGCCTTTGCAGATATTGTAGCAAGAATTTGTGCTCCAATAG
                      ____________________________________________________________
consensus TACCCAACAACTGATAATATGCCTTTGCAGATATTGTAGCAAGAATTTGTGCTCCAATAG
 
. : . : . : . : . : . :
rJMSF022J22+ TTCAATTTGTATGTAATAGCTCAAATTCAATGGGATGTATACATACACT
rJMSF051N15+ TTCAATTTGTATGTAATAGCTCAAATTCAATGGGATGTATACATACACT
rJMSF014H03+ TTCAATTTGTATGTAATAGCTCAAATTCAATGGGATGTATACATACACTTCAATCCTTAA
                      ____________________________________________________________
consensus TTCAATTTGTATGTAATAGCTCAAATTCAATGGGATGTATACATACACTTCAATCCTTAA