Previous Contig 011784:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF018F01Sequence587006398 (9)pir|B84833|B848332e-62hypothetical protein At2g40730 [imported] - Arabidopsis thaliana>gb:AC007660_153682011784 (6)gb:AP003446_18295343e-12Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC clone:OJ15
JMFS028F07Sequence624011784 (6)gb:AP003446_18295344e-19Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC clone:OJ15
JMSF014F15Sequence480006398 (9)pir|B84833|B848332e-48hypothetical protein At2g40730 [imported] - Arabidopsis thaliana>gb:AC007660_153787011784 (6)gb:AP003446_18295345e-15Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC clone:OJ15
JMSF026K23Sequence648006398 (9)pir|B84833|B848331e-72hypothetical protein At2g40730 [imported] - Arabidopsis thaliana>gb:AC007660_153735011784 (6)gb:AP003446_18295342e-18Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC clone:OJ15
JMSF027I21Sequence667011784 (6)gb:AP003446_18295343e-07Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC clone:OJ15
JMSF027I22Sequence688006398 (9)pir|B84833|B848332e-90hypothetical protein At2g40730 [imported] - Arabidopsis thaliana>gb:AC007660_153713011784 (6)gb:AP003446_18295342e-08Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC clone:OJ15

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS028F07- GTAAACCTTCTGAACATAGTTCTGTTACCCCAGCGA
                      ____________________________________________________________
consensus GTAAACCTTCTGAACATAGTTCTGTTACCCCAGCGA
 
. : . : . : . : . : . :
JMFS028F07- ATTCTAGTGCACCACATAGCTCTGCAATTTCCAATGCTAGCTCGGGTACAGAAGATGCAA
                      ____________________________________________________________
consensus ATTCTAGTGCACCACATAGCTCTGCAATTTCCAATGCTAGCTCGGGTACAGAAGATGCAA
 
. : . : . : . : . : . :
JMFS028F07- ATATAGCTCCAATCCAAGTTCGTTCTAGCACGGATATTGCCGATCATCCAGGTCCTGAAT
rJMSF026K23+ GATATTGCCGATCATCCAGGTCCTGAAT
                      ____________________________________________________________
consensus ATATAGCTCCAATCCAAGTTCGTTCTAGCACGGATATTGCCGATCATCCAGGTCCTGAAT
 
. : . : . : . : . : . :
JMFS028F07- CTCCTACATCTACTGATGGATGGGGCGAGCTTGAAAATGGAATTCACGACGATCTCGAAA
rJMSF026K23+ CTCCTACATNTACTGATGGATGGGGCGAGCNTGAAAATGGAATTCACGACGATCTCGAAA
rJMSF014F15+ ATCTCGAAA
                      ____________________________________________________________
consensus CTCCTACATCTACTGATGGATGGGGCGAGCTTGAAAATGGAATTCACGACGATCTCGAAA
 
. : . : . : . : . : . :
JMFS028F07- ATGAAAAAGACGGATGGGATGATATGGAGCCACTAGAAGCTCCGATACCACCTGCAGCTC
rJMSF026K23+ ATGAAAAAGACGGATGGGATGATATGGAGCCACTAGAAGCTCCGATACCACCTGCAGCTC
rJMSF014F15+ ATGAAAAAGACGGATGGGATGATATGGAGCCACTAGAAGCTCCGATACCACCTGCAGCTC
                      ____________________________________________________________
consensus ATGAAAAAGACGGATGGGATGATATGGAGCCACTAGAAGCTCCGATACCACCTGCAGCTC
 
. : . : . : . : . : . :
JMFS028F07- TTGCAAACATCCAAGCTGCTCAAAAACGCCCAGTCTCTCAACCAAAATCACAAGTTTCCA
rJMSF026K23+ TTGCAAACATCCAAGCTGCTCAAAAACGCCCAGTCTCTCAACCAAAATCACAAGTTTCCA
rJMFF018F01+ CTCAACCAAAATCACAAGTTTCCA
rJMSF027I22+ AAAACGCCCAGTCTCTCAACCAAAATCACAAG-TTCCA
rJMSF014F15+ TTGCAAACATCCAAGCTGCTCAAAAACGCCCAGTCTCTCAACCAAAATCACAAGTTTCCA
                      ____________________________________________________________
consensus TTGCAAACATCCAAGCTGCTCAAAAACGCCCAGTCTCTCAACCAAAATCACAAGTTTCCA
 
. : . : . : . : . : . :
JMFS028F07- TTTCAAGACCAAAGAGCATATCAAAGATGAACACAGATGACGATGACTTGTGGGGATCAG
rJMSF026K23+ TTTCAAGACCAAAGAGCATATCAAAGATGAACACAGATGACGATGACTTGTGGGGATCAG
rJMFF018F01+ TTTCAAGACCAAAGAGCATATCAAAGATGAACACAGATGACGATGACTTGTGGGGATCAG
rJMSF027I22+ -TTCNAGACCAAAGAGCATATCAAAGATGAACACAGATGACGATGACTTGTGGGGATCAG
rJMSF027I21+ TCAAGACCAAAGAGCATATCAANGATGAACACAGATGACGATGACTTGTGGGGATCAG
rJMSF014F15+ TTTCAAGACCAAAGAGCATATCAAAGATGAACACAGATGACGATGACTTGTGGGGATCAG
                      ____________________________________________________________
consensus TTTCAAGACCAAAGAGCATATCAAAGATGAACACAGATGACGATGACTTGTGGGGATCAG
 
. : . : . : . : . : . :
JMFS028F07- CAGCTG-CCCCTGTTCCAAAAACTACTAAAGCAGCAAGCTCAA-GGGGGGCTAGCTTTGA
rJMSF026K23+ CAGCTG-CCACTGTTCCAAAAACTACTAAAGCAGCAAGCTCAA-GGGGGGCTAGCTTTGA
rJMFF018F01+ CAGCTGCCCCCTGTTCCAAAAACTACTAAAGCAGCAAGCTCAA-GGGGGGCTAGCTTTGA
rJMSF027I22+ CAGCTG-CCCCTGTTCCAAAAACTACTAAAGCAGCAAGCTCAAGGGGGGGCTAGCTTTGA
rJMSF027I21+ CAGCTG-CCCCTGTTCCAANAACTANTAAAGCAGCAAGCTCAAGGGGGGGCTAGCTTTGA
rJMSF014F15+ CAGCTG-CCCCTGTTCCAAAAACTACTAAAGCAGCAAGCTCAA-GGGGGGCTAGCTTTGA
                      ____________________________________________________________
consensus CAGCTG-CCCCTGTTCCAAAAACTACTAAAGCAGCAAGCTCAA-GGGGGGCTAGCTTTGA
 
. : . : . : . : . : . :
JMFS028F07- TAATGATCCATGGGATTCTGTTGCCCCCGCTCCCAAGACGACTGCAAAAAAGGCTGCAAC
rJMSF026K23+ TAATGATCCATGGGATTCTGTTGCCCCCGCTCCCAAGACGACTGCAAAAAAGGCTGCAAC
rJMFF018F01+ TAATGATCCATGGGATTCTGTTGCCCCCGCTCCCAAGACGACTGCAAAAAAGGCTGCAAC
rJMSF027I22+ TAATGATCCATGGGATTCTGTTGCCCCCGCTCCCAAGACGACTGCAAAAAAGGCTGCAAC
rJMSF027I21+ TAATGATCCATGGGATTCNGTTGCCCCCGCTCCCAAGACGANTGCAAAAAAGGCTGCAAC
rJMSF014F15+ TAATGATCCATGGGATTCTGTTGCCCCCGCTCCCAAGACGACTGCAAAAAAGGCTGCAAC
                      ____________________________________________________________
consensus TAATGATCCATGGGATTCTGTTGCCCCCGCTCCCAAGACGACTGCAAAAAAGGCTGCAAC
 
. : . : . : . : . : . :
JMFS028F07- AGTCGACGATGATCTCTGGGGCTCGATTGCAGCTCCCGAACCAACAACCGCATCAAGACC
rJMSF026K23+ AGTCGACGATGATCTCTGGGGCTCGATTGCAGCTCCCGAACCAACAACCGCATCAAGACC
rJMFF018F01+ AGTCGACGATGATCTCTGGGGCTCGATTGCAGCTCCCGAACCAACAACCGCATCAAGACC
rJMSF027I22+ AGTCGACGATGATCTCTGGGGCTCGATTGCAGCTCCCGAACCAACAACCGCATCAAGACC
rJMSF027I21+ AGTCGACGATGATCTCTGGGGCTCGATTGCAGCTCCCGAACCAACAACCGCATCAAGACC
rJMSF014F15+ AGTCGACGATGATCTCTGGGGCTCGATTGCAGCTCCCGAACCAACAACCGCATCAAGACC
                      ____________________________________________________________
consensus AGTCGACGATGATCTCTGGGGCTCGATTGCAGCTCCCGAACCAACAACCGCATCAAGACC
 
. : . : . : . : . : . :
JMFS028F07- ATCCGTTGGGCGAGGGCGGAGTAAACCTGCTGCTCCC-AACTGGGCGCTCA
rJMSF026K23+ ATCCGTTGGGCGAGGGCGGAGTAAACCTGCTGCTCCCAAACTGGGCGCTCAAAGAATCAA
rJMFF018F01+ ATCCGTTGGGCGAGGGCGGAGTAAACCTGCTGCTCCCAAACTGGGCGCTCAAAGAATCAA
rJMSF027I22+ ATCCGTTGGGCGAGGGCGGAGTAAACCTGCTGCTCCCAAACTGGGCGCTCAAAGAATCAA
rJMSF027I21+ ATCCGTTGGGCGAGGGCGGAGTNAACCTGNTGCTCCCAAACTGGGCGCTCAAAGAATCAA
rJMSF014F15+ ATCCGTTGGGCGAGGGCGGAGTAAACCTGCTGCTCCCAAACTGGGCGCTCAAAGAATCAA
                      ____________________________________________________________
consensus ATCCGTTGGGCGAGGGCGGAGTAAACCTGCTGCTCCCAAACTGGGCGCTCAAAGAATCAA
 
. : . : . : . : . : . :
rJMSF026K23+ CCGAACATCTCCCGGGATGTAAAAGCACAAAAAAAGACCAAGGAGCAGAAATCAGGAAAA
rJMFF018F01+ CCGAACATCTCCCGGGATGTAAAAGCACAAAAAAAGACCAAGGAGCAGAAATCAGGAAAA
rJMSF027I22+ CCGAACATCTCCCGGGATGTAAAAGCACAAAAAAAGACCAAGGAGCAGAAATCAGGAAAA
rJMSF027I21+ CCGAACATCTCCCGGGATGTAAAAGCACAAAAAAAGACCAAGGAGCAGAAATCAGGAAAA
rJMSF014F15+ CCGAACATCTCCCGGGATGTAAAAGCACAAAAAAAGACCAAGGAGCAGAAATCAGGAAAA
                      ____________________________________________________________
consensus CCGAACATCTCCCGGGATGTAAAAGCACAAAAAAAGACCAAGGAGCAGAAATCAGGAAAA
 
. : . : . : . : . : . :
rJMSF026K23+ GAATCTGGACTGCTGTACATTTTCCTCCTCCCTCCCTCTTCTGGTAACTTCCATTTCAAA
rJMFF018F01+ GAATCTGGACTGCTGTACATTTTCCTCCTCCCTCCCTCTTCTGGTAACTTCCATTTCAAA
rJMSF027I22+ GAATCTGGACTGCTGTACATTTTCCTCCTCCCTCCCTCTTCTGGTAACTTCCATTTCAAA
rJMSF027I21+ GAATCTGGACTGCTGTACATTTTCCTCCTCCCTCCCTCTTNTGGTAACTTCCATTTCAAA
rJMSF014F15+ GAATCTGGACTGCTGTACATTTTCCTCCTCCCTCCCTCTTCTGGTAACTTCCATTTCAAA
                      ____________________________________________________________
consensus GAATCTGGACTGCTGTACATTTTCCTCCTCCCTCCCTCTTCTGGTAACTTCCATTTCAAA
 
. : . : . : . : . : . :
rJMSF026K23+ TGACCCAAAATGAAGTGATGTCCCCTAGACAGAGGTTACTAATATGTTTTGCTGACCTCA
rJMFF018F01+ TGACCCAAAATGAAGTGATGTCCCCTAGACAGAGGTTACTAATATGTTTTGCTGACCTCA
rJMSF027I22+ TGACCCAAAATGAAGTGATGTCCCCTAGACAGAGGTTACTAATATGTTTTGCTGACCTCA
rJMSF027I21+ TGACCCAAAATGAAGTGATGTCCCCTAGACAGAGGTTACTAATATGTTTTGCTGACCTCA
rJMSF014F15+ TGACCCAAAATGAAGTGATGTCCCCTAGATAGAGGTTACTAATATGTTTTGCTGACCTCA
                      ____________________________________________________________
consensus TGACCCAAAATGAAGTGATGTCCCCTAGACAGAGGTTACTAATATGTTTTGCTGACCTCA
 
. : . : . : . : . : . :
rJMSF026K23+ TAAGATATGTAATGCCTTAGTTTTCTCAGCCAAACTTCCATTCTTTTT
rJMFF018F01+ TAAGATATGTAATGCCTTAGTTTTCTCAGCCAAACTTCCATTCTTTTTTGCACTGGTTGC
rJMSF027I22+ TAAGATATGTAATGCCTTAGTTTTCTCAGCCAAACTTCCATTCTTTTTTGCACTGGTTGC
rJMSF027I21+ TAAGATATGTAATGCCTTAGTTTTCTCAGCCAAACTTCCATTCTTTTTTGCACTGGTTGC
rJMSF014F15+ TAAGATATGTAATGCCTTAGTTTTCTCAGCCAAACTTCCATTCTTTTTTGCACTGGTTGC
                      ____________________________________________________________
consensus TAAGATATGTAATGCCTTAGTTTTCTCAGCCAAACTTCCATTCTTTTTTGCACTGGTTGC
 
. : . : . : . : . : . :
rJMFF018F01+ ATATAACTCATTCTTTATATACCATCCAAATTCATTATGCCGCTCTGCTGCCGTTGTCTG
rJMSF027I22+ ATATAACTCATTCTTTATATACCATCCAAATTCATTATGCCGCTCTGCTGCCGTTGTCTG
rJMSF027I21+ ATATAACTCATTCTTNATATNCCATCCAAATTCATTATGCCGCTCTGCTGCCGTTGTCTG
rJMSF014F15+ ATATAACTCATTCTTTATATACCATCCAAATTCATTATGCCGCTCTGCTGCCGTTGTCTG
                      ____________________________________________________________
consensus ATATAACTCATTCTTTATATACCATCCAAATTCATTATGCCGCTCTGCTGCCGTTGTCTG
 
. : . : . : . : . : . :
rJMFF018F01+ CCTTTCTTAAAGTGAGTAAAATGTATTGTAATATGCTATAAAGTCTGTACTCCTCATC
rJMSF027I22+ CCTTTCTTAAAGTGAGTAAAATGTATTGTAATATGCTATAAAGTCTGTACTCCTCATC
rJMSF027I21+ CCTTTCTTAAAGTGAGTAAAATGTATTGTAATATGCTATAAAGTCTGTACTCCTCATC
rJMSF014F15+ CCTTTCTTAAAGTGAGTAAAATGTATTGTAATATGCTATAAAGTCTGTACTCCTCATCCT
                      ____________________________________________________________
consensus CCTTTCTTAAAGTGAGTAAAATGTATTGTAATATGCTATAAAGTCTGTACTCCTCATCCT