Previous Contig 011778:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF021O07Sequence538005462 (4)gb:AF461042_18018042e-60Lycopersicon esculentum cytochrome P450 CYP74C4 mRNA, complete cds.658011778 (3)gb:AF461042_18018041e-56Lycopersicon esculentum cytochrome P450 CYP74C4 mRNA, complete cds.
JMSF014E11Sequence510005462 (4)gb:AF461042_18018046e-52Lycopersicon esculentum cytochrome P450 CYP74C4 mRNA, complete cds.781011778 (3)gb:AF461042_18018042e-68Lycopersicon esculentum cytochrome P450 CYP74C4 mRNA, complete cds.
JMSF016P06Sequence471005462 (4)gb:AF461042_18018042e-52Lycopersicon esculentum cytochrome P450 CYP74C4 mRNA, complete cds.740011778 (3)gb:AF461042_18018049e-67Lycopersicon esculentum cytochrome P450 CYP74C4 mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF014E11+ A
                      ____________________________________________________________
consensus A
 
. : . : . : . : . : . :
rJMSF016P06+ AGAAGGTCGGCCTCAAAAGAGACGAAGCCTGTCACAACTTCATCTTCTTC
rJMSF014E11+ GACGACGCCGAGAAGGTCGGCCTCAAAAGAGACGAAGCCTGTCACNACTTCATCTTCTTC
                      ____________________________________________________________
consensus GACGACGCCGAGAAGGTCGGCCTCAAAAGAGACGAAGCCTGTCACAACTTCATCTTCTTC
 
. : . : . : . : . : . :
rJMSF016P06+ GTCTGCTTCAACTCCTACGCCGCCTTCAAGTTCTTCCTCCCGGAGCTCATGAAGTACATC
rJMFF021O07+ GAGCTCATGAAGTACATC
rJMSF014E11+ GTCTGCTTCAACTCCTACGCCGCCTTCAAGTTCTTCCTCCCGGAGCTCATGAAGTACATC
                      ____________________________________________________________
consensus GTCTGCTTCAACTCCTACGCCGCCTTCAAGTTCTTCCTCCCGGAGCTCATGAAGTACATC
 
. : . : . : . : . : . :
rJMSF016P06+ GGCTCCGCCGGGGAGGCCCTCCACCGGCAGCTGGCGGAGGAGATCCGCGGCGCGGTGGAG
rJMFF021O07+ GGCTCCGCCGGGGAGGCCCTCCACCGGCAGCTGGCGGAGGAGATCCGCGGCGCGGTGGAG
rJMSF014E11+ GGCTCCGCCGGGGAGGCCCTCCACCGGCAGCTGGCGGAGGAGATCCGCGGCGCGGTGGAG
                      ____________________________________________________________
consensus GGCTCCGCCGGGGAGGCCCTCCACCGGCAGCTGGCGGAGGAGATCCGCGGCGCGGTGGAG
 
. : . : . : . : . : . :
rJMSF016P06+ CTAGAAGGCGGGAAAATCACCATCAACGCCCTCAACAACATGCCGTTGACCGAATCCGCA
rJMFF021O07+ NTAGAAGGCGGGAAAATCACCATCAACGCCCTCAACAACATGCCGTTGACCGAATCCGCA
rJMSF014E11+ CTAGAAGGCGGGAAAATCACCATCAACGCCCTCAACAACATGCCGTTGACCGAATCCGCA
                      ____________________________________________________________
consensus CTAGAAGGCGGGAAAATCACCATCAACGCCCTCAACAACATGCCGTTGACCGAATCCGCA
 
. : . : . : . : . : . :
rJMSF016P06+ ATCTGGGAAGCTCTCAGGATCGAACCCCCAATCCGGTACCAATACGCAGTAGCCAAGGAG
rJMFF021O07+ ATCTGGGAAGCTCTCAGGATCGAACCCCCAATCCGGTACCAATACGCAGTAGCCAAGGAG
rJMSF014E11+ ATCTGGGAAGCTCTCAGGATCGAACCCCCAATCCGGTACCAATACGCAGTAGCCAAGGAG
                      ____________________________________________________________
consensus ATCTGGGAAGCTCTCAGGATCGAACCCCCAATCCGGTACCAATACGCAGTAGCCAAGGAG
 
. : . : . : . : . : . :
rJMSF016P06+ GACATAACCATCAAAACCTACGACGCTTCCTACCTCGTCAAGAAAGGAGAAACCATATTC
rJMFF021O07+ GACATAACCATCAAAACCTACGACGCTTCCTACCTCGTCAAGAAAGGAGAAACCATATTC
rJMSF014E11+ GACATAACCATCAAAACCTACGACGCTTCCTACCTCGTCAAGAAAGGAGAAACCATATTC
                      ____________________________________________________________
consensus GACATAACCATCAAAACCTACGACGCTTCCTACCTCGTCAAGAAAGGAGAAACCATATTC
 
. : . : . : . : . : . :
rJMSF016P06+ GGGTTCCAACCCTTCGCCACCAAAGACCCCAAGGTTTTCGAAAACCCGGAACAGTATATC
rJMFF021O07+ GGGTTCCAACCCTTCGCCACCAAAGACCCCAAGGTTTTCGAAAACCCGGAACAGTATATC
rJMSF014E11+ GGGTTCCAACCCTTCGCCACCAAAGACCCCAAGGTTTTCGAAAACCCGGAACAGTATATC
                      ____________________________________________________________
consensus GGGTTCCAACCCTTCGCCACCAAAGACCCCAAGGTTTTCGAAAACCCGGAACAGTATATC
 
. : . : . : . : . : . :
rJMSF016P06+ CCGGATAGATTCGTCGGAGAGGGGAAGAAGCTGATCGAGTACGTTTACTGGTCCAACGGG
rJMFF021O07+ CCGGATAGATTCGTCGGAGAGGGGAAGAAGCTGATCGAGTACGTTTACTGGTCCAACGGG
rJMSF014E11+ CCGGATAGATTCGTCGGAGAGGGGAAGAAGCTGATCGAGTACGTTTACTGGTCCAACGGG
                      ____________________________________________________________
consensus CCGGATAGATTCGTCGGAGAGGGGAAGAAGCTGATCGAGTACGTTTACTGGTCCAACGGG
 
. : . : . : . : . : . :
rJMSF016P06+ AGAGGGACTGATATCCCGACGGCGAACGACAAACAGTGCCTGGGAAGGAACATGATTATT
rJMFF021O07+ AGAGGGACTGATATCCCGACGGCGAACGACAAACAGTGCCTGGGAAGGAACATGATTATT
rJMSF014E11+ AGAGGGACTGATATCCCGACGGCGAACGACAAACAGTGCCTGGGAAGGAACATGATTATT
                      ____________________________________________________________
consensus AGAGGGACTGATATCCCGACGGCGAACGACAAACAGTGCCTGGGAAGGAACATGATTATT
 
. : . : . : . : . : . :
rJMSF016P06+ CTGCTTTCAAAGCTGCACTTGGCGGAGTTTTTTCTCCGTTACGATACATTCACCGTTGAG
rJMFF021O07+ CTGCTTTCAAAGCTGCACTTGGCGGAGTTTTTTCTCCGTTACGATACATTCACCGTTGAG
rJMSF014E11+ CTGCTTTCAAAGCTGCACTTGGCGGAGTTTTTTCTCCGTTACGATACATTCACCGTTGAG
                      ____________________________________________________________
consensus CTGCTTTCAAAGCTGCACTTGGCGGAGTTTTTTCTCCGTTACGATACATTCACCGTTGAG
 
. : . : . : . : . : . :
rJMSF016P06+ GTTTCAAAGTACCTTTTCAGCTCCATCGTTAAAGTCAAGTCCCTAACCAAAG
rJMFF021O07+ GTTTCAAAGTACCTTTTCAGCTCCATCGTTAAAGTCAAGTCCCTAACCAAAG
rJMSF014E11+ GTTTCAAAGTACCTTTTCAGCTCCATCGTTAAAGTCAAGTCCCTAACCAAAGCTTCTTCA
                      ____________________________________________________________
consensus GTTTCAAAGTACCTTTTCAGCTCCATCGTTAAAGTCAAGTCCCTAACCAAAGCTTCTTCA
 
. : . : . : . : . : . :
rJMSF014E11+ TCAACATGAAAGCATTAGTCAACTTTTTGGGGATCCGGAATGTTTGATTTGTTTCAACTT
                      ____________________________________________________________
consensus TCAACATGAAAGCATTAGTCAACTTTTTGGGGATCCGGAATGTTTGATTTGTTTCAACTT
 
. : . : . : . : . : . :
rJMSF014E11+ GTATAATTTTCTTTATTTTATATTTCTGTTTTTTTCATAATTCAAATGGATAATAACGTG
                      ____________________________________________________________
consensus GTATAATTTTCTTTATTTTATATTTCTGTTTTTTTCATAATTCAAATGGATAATAACGTG