Previous Contig 011772:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF014B15Sequence316011772 (2)gb:CQ785702_14527636e-35Sequence 15 from Patent WO2004018687.621011772 (2)gb:AY088825_15738352e-41Arabidopsis thaliana clone 96557 mRNA, complete sequence.

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF014B15- AGCACAAAATGGGATCGCTCA
rJMSF014B15+ AGCACAAAATGGGATCGCTCA
                      ____________________________________________________________
consensus AGCACAAAATGGGATCGCTCA
 
. : . : . : . : . : . :
JMSF014B15- TGAGTTTAAACAAGAAGATCAGTAAAGAAGAGATGGAGATGGCTCTTACCAAGGCCAAGG
rJMSF014B15+ TGAGTTTAAACAAGAAGATCAGTAAAGAAGAGATGGAGATGGCTCTTACCAAGGCCAAGG
                      ____________________________________________________________
consensus TGAGTTTAAACAAGAAGATCAGTAAAGAAGAGATGGAGATGGCTCTTACCAAGGCCAAGG
 
. : . : . : . : . : . :
JMSF014B15- AGATTGTTTCTTCTCACCCTGCGGTTGTCTTTAGTAAAACATATTGTGGATATTGCACTA
rJMSF014B15+ AGATTGTTTCTTCTCACCCTGCGGTTGTCTTTAGTAAAACATATTGTGGATATTGCACTA
                      ____________________________________________________________
consensus AGATTGTTTCTTCTCACCCTGCGGTTGTCTTTAGTAAAACATATTGTGGATATTGCACTA
 
. : . : . : . : . : . :
JMSF014B15- GAGTGAAAAACCTTCTTAACCAGCTTGGTGCTGCCTACAAACTCATTGAGCTTGACCAAG
rJMSF014B15+ GAGTGAAAAACCTTCTTAACCAGCTTGGTGCTGCCTACAAACTCATTGAGCTTGACCAAG
                      ____________________________________________________________
consensus GAGTGAAAAACCTTCTTAACCAGCTTGGTGCTGCCTACAAACTCATTGAGCTTGACCAAG
 
. : . : . : . : . : . :
JMSF014B15- AAAATGATGGGGATGCTATTCAGCAAGCCTTGCTGGAGTGGACTGGTCAGAGGACTGTGC
rJMSF014B15+ AAAATGATGGGGATGCTATTCAGCAAGCCTTGCTGGAGTGGACTGGTCAGAGGACTGTGC
                      ____________________________________________________________
consensus AAAATGATGGGGATGCTATTCAGCAAGCCTTGCTGGAGTGGACTGGTCAGAGGACTGTGC
 
. : . : . : . : . : . :
JMSF014B15- CCAATGTTTTCATTGGAGGGAAGCATGTTGGAGGCTGTGATAAAACTTTGGAGAA
rJMSF014B15+ CCAATGTTTTCATTGGAGGGAAGCATGTTGGAGGCTGTGATAAAACTTTGGAGAAGCACC
                      ____________________________________________________________
consensus CCAATGTTTTCATTGGAGGGAAGCATGTTGGAGGCTGTGATAAAACTTTGGAGAAGCACC
 
. : . : . : . : . : . :
rJMSF014B15+ AACAAGGGCAGCTTGTAGCCATGCTAACCGATGCTGGCGCCATTACCACCAAATCTGCTC
                      ____________________________________________________________
consensus AACAAGGGCAGCTTGTAGCCATGCTAACCGATGCTGGCGCCATTACCACCAAATCTGCTC
 
. : . : . : . : . : . :
rJMSF014B15+ AACTCACCAATGTCAATGCTGTCTAACTATATAGACTCAAGTAAATCTCTGTATAAACTG
                      ____________________________________________________________
consensus AACTCACCAATGTCAATGCTGTCTAACTATATAGACTCAAGTAAATCTCTGTATAAACTG
 
. : . : . : . : . : . :
rJMSF014B15+ TTCCTCCTAGAGTTTAATAATATTGGTTGAAGAAGAAGATGATGATGATGATGATGTTGC
                      ____________________________________________________________
consensus TTCCTCCTAGAGTTTAATAATATTGGTTGAAGAAGAAGATGATGATGATGATGATGTTGC
 
. : . : . : . : . : . :
rJMSF014B15+ AACCAAATGGTCCTTTTGCTTTTCCTCAGTAGATTGGCTTACTGGCCTTTTACAGGGTTG
                      ____________________________________________________________
consensus AACCAAATGGTCCTTTTGCTTTTCCTCAGTAGATTGGCTTACTGGCCTTTTACAGGGTTG
 
. : . : . : . : . : . :
rJMSF014B15+ GATTATTGTGTAAGATATATAAGTACATGTTTCTGTTATTTTGCTTCAGTTGTTCAACTG
                      ____________________________________________________________
consensus GATTATTGTGTAAGATATATAAGTACATGTTTCTGTTATTTTGCTTCAGTTGTTCAACTG